Incidental Mutation 'R5061:Lama5'
ID386599
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 042651-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5061 (G1)
Quality Score163
Status Validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 180198786 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 607 (E607*)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791]
PDB Structure
LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000015791
AA Change: E607*
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: E607*

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Meta Mutation Damage Score 0.68 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACTCCACACTGCTGATCCAG -3'
(R):5'- TTGCAGCATGCCAGTGTTC -3'

Sequencing Primer
(F):5'- GGTCACAGGCACAAGCTG -3'
(R):5'- GTAGCCAACAGCCTCTGTGAC -3'
Posted On2016-06-06