Incidental Mutation 'R5061:Ebf3'
ID386619
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Nameearly B cell factor 3
SynonymsOlf-1/EBF-like 2, O/E-2, 3110018A08Rik
MMRRC Submission 042651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location137193673-137314445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137313559 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 84 (I84V)
Ref Sequence ENSEMBL: ENSMUSP00000132563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000210774]
Predicted Effect probably benign
Transcript: ENSMUST00000033378
AA Change: I84V

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: I84V

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106118
AA Change: I84V

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: I84V

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168203
AA Change: I84V

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: I84V

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169486
AA Change: I84V

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: I84V

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209864
Predicted Effect probably benign
Transcript: ENSMUST00000210774
AA Change: I84V

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R0962:Ebf3 UTSW 7 137225203 missense probably damaging 0.99
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4298:Ebf3 UTSW 7 137225229 missense possibly damaging 0.95
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6634:Ebf3 UTSW 7 137201160 missense probably damaging 0.99
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAGAAGTTGTTCGGCCCTTG -3'
(R):5'- ATTCAGGAGAATATTCCGCGC -3'

Sequencing Primer
(F):5'- ATGCGCGGGCACCAACTGCCCCCTA -3'
(R):5'- AGAATATTCCGCGCGGGGG -3'
Posted On2016-06-06