Incidental Mutation 'R5061:Gja1'
ID386626
Institutional Source Beutler Lab
Gene Symbol Gja1
Ensembl Gene ENSMUSG00000050953
Gene Namegap junction protein, alpha 1
Synonymsconnexin43, Cx43alpha1, Gja-1, alpha 1 connexin, connexin 43, Cx43
MMRRC Submission 042651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location56377330-56402513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56387656 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 37 (L37Q)
Ref Sequence ENSEMBL: ENSMUSP00000151620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068581] [ENSMUST00000217789] [ENSMUST00000218444] [ENSMUST00000218834] [ENSMUST00000220069] [ENSMUST00000220194]
Predicted Effect probably damaging
Transcript: ENSMUST00000068581
AA Change: L37Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064536
Gene: ENSMUSG00000050953
AA Change: L37Q

DomainStartEndE-ValueType
CNX 43 76 5.34e-20 SMART
low complexity region 102 114 N/A INTRINSIC
Connexin_CCC 165 231 5.06e-39 SMART
Pfam:Connexin43 293 312 5e-14 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217789
Predicted Effect probably damaging
Transcript: ENSMUST00000218444
AA Change: L37Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218834
Predicted Effect probably damaging
Transcript: ENSMUST00000220069
AA Change: L37Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220204
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia, autosomal recessive craniometaphyseal dysplasia and heart malformations. [provided by RefSeq, May 2014]
PHENOTYPE: Mutant homozygotes are neonatal lethal with heart and outflow tract malformations, eye lens anomalies, and male germ cell deficiency. Conditional deletion in ovary affects follicular development, in astrocytes enhances locomotor activity, and in neural cells produces behavioral and neural defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Gja1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Gja1 APN 10 56388322 missense probably benign 0.03
IGL01660:Gja1 APN 10 56388448 missense probably damaging 1.00
IGL02387:Gja1 APN 10 56387806 missense possibly damaging 0.48
IGL02596:Gja1 APN 10 56388252 missense possibly damaging 0.77
R0607:Gja1 UTSW 10 56388070 missense possibly damaging 0.58
R1386:Gja1 UTSW 10 56387969 missense probably benign 0.01
R4084:Gja1 UTSW 10 56388511 missense possibly damaging 0.70
R4542:Gja1 UTSW 10 56388052 missense probably damaging 1.00
R4601:Gja1 UTSW 10 56388229 missense probably damaging 1.00
R5301:Gja1 UTSW 10 56388379 missense probably damaging 0.96
R5740:Gja1 UTSW 10 56388189 missense probably damaging 0.99
R5808:Gja1 UTSW 10 56388498 missense probably benign 0.14
R6120:Gja1 UTSW 10 56388505 missense probably benign 0.00
R6192:Gja1 UTSW 10 56388234 missense probably damaging 1.00
R7057:Gja1 UTSW 10 56388033 missense probably benign 0.30
R7227:Gja1 UTSW 10 56387656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACTGCCTTATTTTGACTGACC -3'
(R):5'- ACACGTGAGCCAAGTACAGG -3'

Sequencing Primer
(F):5'- TGTGAAACCATCAATTTACAGTCTAC -3'
(R):5'- CCAAGTACAGGAGTGTGGGC -3'
Posted On2016-06-06