Incidental Mutation 'R5061:Prss38'
ID386632
Institutional Source Beutler Lab
Gene Symbol Prss38
Ensembl Gene ENSMUSG00000049291
Gene Nameprotease, serine 38
SynonymsGm249, LOC216797
MMRRC Submission 042651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59372669-59375657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59374370 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 123 (T123A)
Ref Sequence ENSEMBL: ENSMUSP00000052010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061481]
Predicted Effect probably damaging
Transcript: ENSMUST00000061481
AA Change: T123A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052010
Gene: ENSMUSG00000049291
AA Change: T123A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 55 284 7.08e-75 SMART
low complexity region 288 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133698
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Prss38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03075:Prss38 APN 11 59373055 missense probably damaging 1.00
LCD18:Prss38 UTSW 11 59375641 utr 5 prime probably benign
R0001:Prss38 UTSW 11 59373180 splice site probably benign
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0540:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R0607:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R1966:Prss38 UTSW 11 59373484 missense probably damaging 1.00
R4394:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4397:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4529:Prss38 UTSW 11 59373499 missense probably damaging 1.00
R4738:Prss38 UTSW 11 59372945 missense probably benign 0.00
R5219:Prss38 UTSW 11 59375483 splice site probably benign
R5306:Prss38 UTSW 11 59372995 missense probably benign 0.00
R6894:Prss38 UTSW 11 59373024 missense probably benign 0.19
R7286:Prss38 UTSW 11 59375558 missense probably benign 0.00
T0970:Prss38 UTSW 11 59373148 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTTAGCTCATACCTTGTGGCGAG -3'
(R):5'- TCAGATAGGCCTACACTGTGC -3'

Sequencing Primer
(F):5'- GAGATCATTCCCCATCCGGTAG -3'
(R):5'- ATAGGCCTACACTGTGCTGCAAG -3'
Posted On2016-06-06