Incidental Mutation 'R5061:Akap8l'
ID386649
Institutional Source Beutler Lab
Gene Symbol Akap8l
Ensembl Gene ENSMUSG00000002625
Gene NameA kinase (PRKA) anchor protein 8-like
SynonymsNakap95
MMRRC Submission 042651-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32321425-32350581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32332894 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 441 (K441T)
Ref Sequence ENSEMBL: ENSMUSP00000051389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050214]
Predicted Effect probably damaging
Transcript: ENSMUST00000050214
AA Change: K441T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625
AA Change: K441T

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Akap8l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Akap8l APN 17 32333097 missense possibly damaging 0.82
IGL01603:Akap8l APN 17 32345353 missense probably damaging 1.00
IGL02028:Akap8l APN 17 32338521 splice site probably null
IGL02033:Akap8l APN 17 32338272 missense probably damaging 1.00
IGL02301:Akap8l APN 17 32332926 splice site probably benign
R1136:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1137:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1192:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1277:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1279:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1703:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1705:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1706:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1727:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1763:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1774:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1796:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1954:Akap8l UTSW 17 32336736 missense possibly damaging 0.74
R2072:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2073:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2074:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2107:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2108:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2214:Akap8l UTSW 17 32338825 critical splice acceptor site probably null
R2215:Akap8l UTSW 17 32321595 missense possibly damaging 0.72
R2219:Akap8l UTSW 17 32334631 missense probably benign 0.23
R2234:Akap8l UTSW 17 32338803 missense probably damaging 1.00
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R4273:Akap8l UTSW 17 32321931 nonsense probably null
R4379:Akap8l UTSW 17 32321514 unclassified probably benign
R5337:Akap8l UTSW 17 32336394 missense possibly damaging 0.71
R5377:Akap8l UTSW 17 32321511 unclassified probably benign
R5579:Akap8l UTSW 17 32321942 missense probably damaging 1.00
R5609:Akap8l UTSW 17 32338400 missense probably damaging 1.00
R5667:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5671:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5747:Akap8l UTSW 17 32345378 missense probably damaging 0.97
R6186:Akap8l UTSW 17 32333044 missense probably benign 0.02
R6400:Akap8l UTSW 17 32336320 missense probably damaging 0.99
R6482:Akap8l UTSW 17 32345396 missense possibly damaging 0.94
R6712:Akap8l UTSW 17 32332888 missense probably damaging 1.00
V5088:Akap8l UTSW 17 32336739 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTACACGAGCCTGAGACTG -3'
(R):5'- ATGGGTAGCCACCTTGACAG -3'

Sequencing Primer
(F):5'- CGAGCCTGAGACTGGTGAAC -3'
(R):5'- TTGACAGCAAGTTCCACAAGG -3'
Posted On2016-06-06