Mutagenetix > Incidental Mutation

Incidental Mutation 'R5062:Col6a3'

386658

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

042652-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90694582-90771710 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 90707074 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 2013 (I2013S)

Ref Sequence

ENSEMBL: ENSMUSP00000140858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000188587]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000056925
AA Change: I2620S

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: I2620S

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000097653
AA Change: I2013S

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: I2013S

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000188587
AA Change: I2013S

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: I2013S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Meta Mutation Damage Score

0.4362

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,067,892 (GRCm39)	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,369,041 (GRCm39)	K173N	probably damaging	Het
Artn	A	T	4: 117,784,873 (GRCm39)	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,655,775 (GRCm39)	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,051,118 (GRCm39)	M420K	probably benign	Het
Bcam	T	A	7: 19,494,026 (GRCm39)	T422S	possibly damaging	Het
Casp2	C	T	6: 42,246,206 (GRCm39)		probably benign	Het
Ccdc137	A	G	11: 120,353,341 (GRCm39)		probably benign	Het
Cd177	C	A	7: 24,443,741 (GRCm39)	A786S	probably benign	Het
Cdca4	T	C	12: 112,785,483 (GRCm39)	N82D	probably benign	Het
Clu	A	C	14: 66,217,177 (GRCm39)	T337P	probably damaging	Het
Cpne9	T	A	6: 113,281,449 (GRCm39)	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,897,161 (GRCm39)	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,842,527 (GRCm39)	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,233,236 (GRCm39)	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,257,575 (GRCm39)	Y312S	probably damaging	Het
Fshr	A	T	17: 89,293,474 (GRCm39)	C401*	probably null	Het
Glyat	A	C	19: 12,627,627 (GRCm39)	Q74P	probably damaging	Het
Gm6158	A	T	14: 24,120,158 (GRCm39)		noncoding transcript	Het
Grm7	A	G	6: 110,623,097 (GRCm39)	N90S	probably damaging	Het
Hectd1	A	T	12: 51,791,662 (GRCm39)	C2536S	probably damaging	Het
Herc3	C	T	6: 58,832,745 (GRCm39)	Q137*	probably null	Het
Kctd3	A	C	1: 188,727,890 (GRCm39)		probably benign	Het
Klhl30	A	G	1: 91,283,300 (GRCm39)	T301A	probably benign	Het
Klra9	T	C	6: 130,156,072 (GRCm39)	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,795,679 (GRCm39)	T355S	possibly damaging	Het
Lcmt1	A	C	7: 123,010,053 (GRCm39)		probably null	Het
Limch1	C	T	5: 67,126,578 (GRCm39)	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,377,528 (GRCm39)	D203G	probably damaging	Het
Mc5r	T	C	18: 68,472,352 (GRCm39)	L237P	probably damaging	Het
Mknk2	G	A	10: 80,507,603 (GRCm39)	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,152,676 (GRCm39)		probably benign	Het
Mroh2a	GCCC	GC	1: 88,159,979 (GRCm39)		probably null	Het
Nae1	A	T	8: 105,243,334 (GRCm39)	C395S	possibly damaging	Het
Ncoa1	A	G	12: 4,309,333 (GRCm39)	M1321T	probably damaging	Het
Neb	A	C	2: 52,170,513 (GRCm39)	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,472,198 (GRCm39)	V64I	probably benign	Het
Nisch	T	A	14: 30,894,397 (GRCm39)	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,135,335 (GRCm39)	R1009*	probably null	Het
Or12d13	A	T	17: 37,647,822 (GRCm39)	H100Q	probably damaging	Het
Or4k15	T	A	14: 50,364,894 (GRCm39)	Y287N	probably damaging	Het
Otx1	C	A	11: 21,947,037 (GRCm39)	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,161,621 (GRCm39)		probably benign	Het
Pcm1	T	C	8: 41,712,297 (GRCm39)	V189A	probably damaging	Het
Peak1	G	T	9: 56,167,573 (GRCm39)	N118K	probably damaging	Het
Phgdh	T	A	3: 98,235,655 (GRCm39)	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,127,261 (GRCm39)	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,655,935 (GRCm39)	C199W	probably benign	Het
Plat	A	G	8: 23,262,327 (GRCm39)	D117G	probably benign	Het
Ppp2r2b	C	A	18: 42,821,526 (GRCm39)	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,127,294 (GRCm39)	D60G	probably damaging	Het
Ryr2	T	C	13: 11,715,240 (GRCm39)	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,592,059 (GRCm39)		probably null	Het
Sharpin	T	C	15: 76,231,811 (GRCm39)		probably benign	Het
Slamf6	A	G	1: 171,764,100 (GRCm39)	I164M	possibly damaging	Het
Slco1a7	A	C	6: 141,713,180 (GRCm39)	M67R	possibly damaging	Het
Spef1	A	G	2: 131,015,201 (GRCm39)	Y46H	probably damaging	Het
Spns1	G	A	7: 125,973,501 (GRCm39)		probably benign	Het
Supt5	C	T	7: 28,028,440 (GRCm39)		probably null	Het
Tbx5	T	A	5: 119,974,987 (GRCm39)	D3E	probably damaging	Het
Thbs1	T	C	2: 117,951,718 (GRCm39)		probably null	Het
Tmem140	G	A	6: 34,849,897 (GRCm39)	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,869,813 (GRCm39)	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,649,848 (GRCm39)	D256G	probably damaging	Het
Tns1	A	T	1: 73,992,023 (GRCm39)	L885Q	probably damaging	Het
Umod	G	A	7: 119,071,644 (GRCm39)	Q366*	probably null	Het
Vsir	A	G	10: 60,200,042 (GRCm39)	I208V	probably damaging	Het
Zfp646	G	A	7: 127,479,671 (GRCm39)	R616H	probably damaging	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90,755,977 (GRCm39)	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90,709,748 (GRCm39)	missense	unknown
IGL00541:Col6a3	APN	1	90,729,864 (GRCm39)	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90,730,054 (GRCm39)	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90,731,655 (GRCm39)	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90,735,232 (GRCm39)	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90,730,236 (GRCm39)	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90,706,884 (GRCm39)	missense	unknown
IGL01827:Col6a3	APN	1	90,730,041 (GRCm39)	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90,724,293 (GRCm39)	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90,700,770 (GRCm39)	missense	unknown
IGL01900:Col6a3	APN	1	90,722,732 (GRCm39)	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90,729,958 (GRCm39)	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90,709,858 (GRCm39)	splice site	probably benign
IGL02115:Col6a3	APN	1	90,735,373 (GRCm39)	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90,709,482 (GRCm39)	missense	unknown
IGL02313:Col6a3	APN	1	90,739,328 (GRCm39)	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90,706,919 (GRCm39)	missense	unknown
IGL02821:Col6a3	APN	1	90,731,600 (GRCm39)	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90,724,281 (GRCm39)	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90,739,242 (GRCm39)	nonsense	probably null
IGL03129:Col6a3	APN	1	90,749,584 (GRCm39)	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90,731,615 (GRCm39)	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90,755,588 (GRCm39)	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90,737,898 (GRCm39)	missense	probably damaging	1.00
bailey	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
barnum	UTSW	1	90,706,874 (GRCm39)	missense	unknown
Boneless	UTSW	1	90,706,781 (GRCm39)	missense	unknown
Noodloid	UTSW	1	90,707,011 (GRCm39)	missense	unknown
randolf	UTSW	1	90,715,673 (GRCm39)	missense	unknown
stringy	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
wonder	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90,737,970 (GRCm39)	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90,706,516 (GRCm39)	missense	unknown
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90,725,883 (GRCm39)	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90,741,273 (GRCm39)	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90,725,895 (GRCm39)	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90,735,426 (GRCm39)	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90,755,771 (GRCm39)	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R0512:Col6a3	UTSW	1	90,749,520 (GRCm39)	intron	probably benign
R0564:Col6a3	UTSW	1	90,735,456 (GRCm39)	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90,735,808 (GRCm39)	splice site	probably null
R0667:Col6a3	UTSW	1	90,755,823 (GRCm39)	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90,706,703 (GRCm39)	missense	unknown
R0736:Col6a3	UTSW	1	90,731,811 (GRCm39)	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90,756,020 (GRCm39)	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90,730,375 (GRCm39)	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90,722,047 (GRCm39)	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1225:Col6a3	UTSW	1	90,739,238 (GRCm39)	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90,696,069 (GRCm39)	missense	unknown
R1387:Col6a3	UTSW	1	90,750,138 (GRCm39)	intron	probably benign
R1437:Col6a3	UTSW	1	90,729,098 (GRCm39)	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1677:Col6a3	UTSW	1	90,749,583 (GRCm39)	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90,701,224 (GRCm39)	missense	unknown
R1711:Col6a3	UTSW	1	90,757,935 (GRCm39)	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90,724,296 (GRCm39)	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90,706,781 (GRCm39)	missense	unknown
R1738:Col6a3	UTSW	1	90,744,083 (GRCm39)	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90,741,516 (GRCm39)	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90,755,671 (GRCm39)	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90,757,936 (GRCm39)	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90,739,421 (GRCm39)	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90,750,081 (GRCm39)	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90,731,897 (GRCm39)	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90,709,733 (GRCm39)	missense	unknown
R2121:Col6a3	UTSW	1	90,738,087 (GRCm39)	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90,731,467 (GRCm39)	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90,741,080 (GRCm39)	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90,731,435 (GRCm39)	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90,703,321 (GRCm39)	missense	unknown
R3052:Col6a3	UTSW	1	90,729,852 (GRCm39)	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90,707,803 (GRCm39)	missense	unknown
R4007:Col6a3	UTSW	1	90,730,291 (GRCm39)	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90,749,605 (GRCm39)	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90,729,105 (GRCm39)	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90,714,361 (GRCm39)	missense	unknown
R4297:Col6a3	UTSW	1	90,739,100 (GRCm39)	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90,709,626 (GRCm39)	missense	unknown
R4683:Col6a3	UTSW	1	90,701,179 (GRCm39)	missense	unknown
R4788:Col6a3	UTSW	1	90,700,672 (GRCm39)	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90,707,011 (GRCm39)	missense	unknown
R4899:Col6a3	UTSW	1	90,730,149 (GRCm39)	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90,729,164 (GRCm39)	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90,735,246 (GRCm39)	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90,731,940 (GRCm39)	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90,706,565 (GRCm39)	missense	unknown
R5057:Col6a3	UTSW	1	90,743,852 (GRCm39)	missense	possibly damaging	0.91
R5105:Col6a3	UTSW	1	90,725,862 (GRCm39)	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90,696,067 (GRCm39)	missense	unknown
R5166:Col6a3	UTSW	1	90,738,330 (GRCm39)	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90,701,361 (GRCm39)	nonsense	probably null
R5196:Col6a3	UTSW	1	90,744,260 (GRCm39)	splice site	probably null
R5230:Col6a3	UTSW	1	90,716,776 (GRCm39)	missense	unknown
R5268:Col6a3	UTSW	1	90,712,965 (GRCm39)	missense	unknown
R5381:Col6a3	UTSW	1	90,703,334 (GRCm39)	missense	unknown
R5392:Col6a3	UTSW	1	90,729,017 (GRCm39)	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90,709,761 (GRCm39)	nonsense	probably null
R5571:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R5665:Col6a3	UTSW	1	90,755,602 (GRCm39)	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90,729,921 (GRCm39)	splice site	probably null
R5914:Col6a3	UTSW	1	90,703,922 (GRCm39)	missense	unknown
R5955:Col6a3	UTSW	1	90,739,163 (GRCm39)	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90,749,571 (GRCm39)	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90,696,105 (GRCm39)	missense	unknown
R6010:Col6a3	UTSW	1	90,701,219 (GRCm39)	missense	unknown
R6025:Col6a3	UTSW	1	90,755,824 (GRCm39)	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90,741,475 (GRCm39)	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90,701,387 (GRCm39)	missense	unknown
R6181:Col6a3	UTSW	1	90,744,096 (GRCm39)	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90,750,063 (GRCm39)	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90,749,955 (GRCm39)	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90,738,285 (GRCm39)	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90,709,534 (GRCm39)	missense	unknown
R6484:Col6a3	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6703:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6703:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6724:Col6a3	UTSW	1	90,706,874 (GRCm39)	missense	unknown
R6746:Col6a3	UTSW	1	90,706,767 (GRCm39)	missense	unknown
R6797:Col6a3	UTSW	1	90,731,810 (GRCm39)	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90,722,731 (GRCm39)	splice site	probably null
R6903:Col6a3	UTSW	1	90,721,929 (GRCm39)	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90,743,724 (GRCm39)	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90,735,192 (GRCm39)	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90,755,759 (GRCm39)	nonsense	probably null
R7182:Col6a3	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
R7294:Col6a3	UTSW	1	90,756,005 (GRCm39)	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90,755,708 (GRCm39)	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90,750,013 (GRCm39)	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90,755,855 (GRCm39)	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90,703,463 (GRCm39)	missense	unknown
R7575:Col6a3	UTSW	1	90,738,321 (GRCm39)	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90,709,467 (GRCm39)	missense	unknown
R7679:Col6a3	UTSW	1	90,739,473 (GRCm39)	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90,724,268 (GRCm39)	nonsense	probably null
R7855:Col6a3	UTSW	1	90,738,343 (GRCm39)	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R8003:Col6a3	UTSW	1	90,703,455 (GRCm39)	missense	unknown
R8007:Col6a3	UTSW	1	90,705,179 (GRCm39)	missense	unknown
R8098:Col6a3	UTSW	1	90,731,383 (GRCm39)	missense	probably benign
R8312:Col6a3	UTSW	1	90,741,412 (GRCm39)	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90,729,935 (GRCm39)	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90,727,747 (GRCm39)	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90,696,171 (GRCm39)	missense	unknown
R8857:Col6a3	UTSW	1	90,703,485 (GRCm39)	missense	unknown
R8867:Col6a3	UTSW	1	90,715,673 (GRCm39)	missense	unknown
R8887:Col6a3	UTSW	1	90,755,948 (GRCm39)	missense	probably benign
R9011:Col6a3	UTSW	1	90,710,057 (GRCm39)	splice site	probably benign
R9049:Col6a3	UTSW	1	90,707,066 (GRCm39)	missense	unknown
R9142:Col6a3	UTSW	1	90,706,566 (GRCm39)	missense	unknown
R9155:Col6a3	UTSW	1	90,738,301 (GRCm39)	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9258:Col6a3	UTSW	1	90,700,703 (GRCm39)	missense	unknown
R9274:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9276:Col6a3	UTSW	1	90,735,403 (GRCm39)	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90,738,979 (GRCm39)	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90,709,523 (GRCm39)	missense	unknown
R9377:Col6a3	UTSW	1	90,743,961 (GRCm39)	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90,731,585 (GRCm39)	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90,744,155 (GRCm39)	missense	probably damaging	1.00
R9440:Col6a3	UTSW	1	90,707,068 (GRCm39)	missense	unknown
R9441:Col6a3	UTSW	1	90,705,249 (GRCm39)	nonsense	probably null
R9477:Col6a3	UTSW	1	90,706,621 (GRCm39)	missense	unknown
R9498:Col6a3	UTSW	1	90,713,650 (GRCm39)	nonsense	probably null
R9528:Col6a3	UTSW	1	90,731,789 (GRCm39)	missense	probably damaging	1.00
R9602:Col6a3	UTSW	1	90,731,497 (GRCm39)	missense	probably benign	0.07
RF005:Col6a3	UTSW	1	90,738,984 (GRCm39)	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90,738,282 (GRCm39)	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90,731,359 (GRCm39)	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90,731,627 (GRCm39)	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90,739,251 (GRCm39)	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90,739,450 (GRCm39)	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGCACCATAGTCTGTCAGTG -3'
(R):5'- GATGATTGTAGTCACTTGAGTCCC -3'

Sequencing Primer
(F):5'- AGTCTGTCAGTGAGAATTCCACC -3'
(R):5'- GTCACTTGAGTCCCAGAAAATTGG -3'

Posted On

2016-06-06