Incidental Mutation 'R0426:Cdc27'
ID38668
Institutional Source Beutler Lab
Gene Symbol Cdc27
Ensembl Gene ENSMUSG00000020687
Gene Namecell division cycle 27
SynonymsAPC3
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R0426 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104502745-104550620 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 104513027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093923] [ENSMUST00000106962]
Predicted Effect probably null
Transcript: ENSMUST00000093923
SMART Domains Protein: ENSMUSP00000091452
Gene: ENSMUSG00000020687

DomainStartEndE-ValueType
Pfam:Apc3 17 95 2.2e-23 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 349 362 N/A INTRINSIC
TPR 500 533 1.33e1 SMART
TPR 568 601 2.91e-6 SMART
TPR 602 635 7.06e-5 SMART
TPR 636 669 3.96e-8 SMART
TPR 670 703 7.45e-4 SMART
TPR 704 737 6.92e1 SMART
TPR 738 771 1.17e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106962
SMART Domains Protein: ENSMUSP00000102575
Gene: ENSMUSG00000020687

DomainStartEndE-ValueType
Pfam:ANAPC3 17 94 7.7e-25 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 355 368 N/A INTRINSIC
TPR 506 539 1.33e1 SMART
TPR 574 607 2.91e-6 SMART
TPR 608 641 7.06e-5 SMART
TPR 642 675 3.96e-8 SMART
TPR 676 709 7.45e-4 SMART
TPR 710 743 6.92e1 SMART
TPR 744 777 1.17e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127506
Meta Mutation Damage Score 0.6176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of the anaphase-promoting complex (APC), which is composed of eight protein subunits and is highly conserved in eukaryotic cells. This complex catalyzes the formation of cyclin B-ubiquitin conjugate, which is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. The protein encoded by this gene and three other members of the APC complex contain tetratricopeptide (TPR) repeats, which are important for protein-protein interactions. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and it may thus be involved in controlling the timing of mitosis. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 22 and Y. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Cdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cdc27 APN 11 104521432 missense probably benign 0.01
IGL00673:Cdc27 APN 11 104528435 missense probably damaging 1.00
IGL00949:Cdc27 APN 11 104529403 missense probably damaging 1.00
IGL01529:Cdc27 APN 11 104507216 missense probably damaging 1.00
IGL01894:Cdc27 APN 11 104526921 missense probably benign 0.00
IGL02096:Cdc27 APN 11 104528568 splice site probably benign
IGL02124:Cdc27 APN 11 104522731 missense probably damaging 0.99
IGL02444:Cdc27 APN 11 104522716 splice site probably benign
IGL02589:Cdc27 APN 11 104505644 missense probably benign 0.04
IGL02851:Cdc27 APN 11 104526981 splice site probably benign
IGL02861:Cdc27 APN 11 104522831 splice site probably benign
IGL02952:Cdc27 APN 11 104517464 missense probably damaging 1.00
IGL03103:Cdc27 APN 11 104512980 missense probably benign 0.21
R0344:Cdc27 UTSW 11 104526991 splice site probably benign
R0365:Cdc27 UTSW 11 104528424 missense possibly damaging 0.68
R0366:Cdc27 UTSW 11 104505648 missense probably damaging 0.99
R0505:Cdc27 UTSW 11 104528288 missense probably benign
R0639:Cdc27 UTSW 11 104531734 missense probably damaging 1.00
R0925:Cdc27 UTSW 11 104526049 critical splice donor site probably null
R0927:Cdc27 UTSW 11 104505641 missense possibly damaging 0.88
R1414:Cdc27 UTSW 11 104521425 missense probably benign 0.26
R1765:Cdc27 UTSW 11 104534781 missense probably damaging 1.00
R1822:Cdc27 UTSW 11 104522822 missense probably benign 0.16
R2449:Cdc27 UTSW 11 104505638 missense probably benign 0.03
R3404:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3405:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3406:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3776:Cdc27 UTSW 11 104515437 missense probably damaging 1.00
R4037:Cdc27 UTSW 11 104507207 missense probably damaging 1.00
R4385:Cdc27 UTSW 11 104534814 missense probably benign 0.10
R4451:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4452:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4530:Cdc27 UTSW 11 104528426 missense possibly damaging 0.68
R4956:Cdc27 UTSW 11 104529395 missense probably damaging 0.99
R4988:Cdc27 UTSW 11 104526124 missense possibly damaging 0.95
R5098:Cdc27 UTSW 11 104507287 missense probably damaging 1.00
R5130:Cdc27 UTSW 11 104534774 missense probably benign 0.07
R5384:Cdc27 UTSW 11 104507140 missense probably benign 0.02
R5876:Cdc27 UTSW 11 104515418 missense probably benign 0.30
R6238:Cdc27 UTSW 11 104528444 missense probably damaging 1.00
R6318:Cdc27 UTSW 11 104528694 missense probably damaging 1.00
R6354:Cdc27 UTSW 11 104534748 missense probably damaging 1.00
R6467:Cdc27 UTSW 11 104522776 missense probably damaging 1.00
R6485:Cdc27 UTSW 11 104505648 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGGCTCTGGCTAAGCTGCAAAG -3'
(R):5'- TGCAGGAATTGGCTGTTCTGTCTAC -3'

Sequencing Primer
(F):5'- GCTAAGCTGCAAAGACTCTTG -3'
(R):5'- CTACATTAGAGTGGTGAGTTTCAAG -3'
Posted On2013-05-23