Incidental Mutation 'R5063:Cenpe'
ID386733
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5063 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135270954 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 2441 (C2441S)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
Predicted Effect probably damaging
Transcript: ENSMUST00000062893
AA Change: C2441S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: C2441S

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199497
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Anapc1 T C 2: 128,629,549 M1496V possibly damaging Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Casp8 A T 1: 58,844,374 H280L probably damaging Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip1l A G 9: 99,667,652 E725G probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Msh5 A T 17: 35,042,188 probably null Het
Neb G A 2: 52,223,212 probably benign Het
Olfr16 T A 1: 172,957,442 S216T possibly damaging Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slc25a45 T C 19: 5,884,462 S153P possibly damaging Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tm9sf2 T A 14: 122,145,146 F190Y probably damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGTGACTCGGACAGATTCTAAAAGG -3'
(R):5'- GTGTGGAAATGACTCCTCCTCC -3'

Sequencing Primer
(F):5'- GGAGACAGAACACAACTTCTCAGTG -3'
(R):5'- TGGAGGACTGAGATACCCGC -3'
Posted On2016-06-06