Incidental Mutation 'R5063:Psmc1'
ID 386761
Institutional Source Beutler Lab
Gene Symbol Psmc1
Ensembl Gene ENSMUSG00000021178
Gene Name protease (prosome, macropain) 26S subunit, ATPase 1
Synonyms P26s4, Rpt2/S4, rpt2, S4
MMRRC Submission 042653-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5063 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 100076461-100089623 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100081734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 112 (L112S)
Ref Sequence ENSEMBL: ENSMUSP00000021595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021595]
AlphaFold P62192
Predicted Effect probably damaging
Transcript: ENSMUST00000021595
AA Change: L112S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178
AA Change: L112S

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
AAA 218 357 1.57e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223078
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 119,901,315 (GRCm39) H970R probably benign Het
Anapc1 T C 2: 128,471,469 (GRCm39) M1496V possibly damaging Het
Arhgef4 A T 1: 34,763,296 (GRCm39) T851S probably benign Het
Armh3 A G 19: 45,874,394 (GRCm39) I593T possibly damaging Het
Cacna1d A G 14: 29,773,340 (GRCm39) S1782P probably benign Het
Capn13 T A 17: 73,629,074 (GRCm39) R578* probably null Het
Casp8 A T 1: 58,883,533 (GRCm39) H280L probably damaging Het
Cd274 G T 19: 29,361,543 (GRCm39) D284Y probably damaging Het
Cenpe T A 3: 134,976,715 (GRCm39) C2441S probably damaging Het
Chn2 A T 6: 54,267,272 (GRCm39) K118* probably null Het
Chst12 G T 5: 140,510,167 (GRCm39) E265* probably null Het
Cp C A 3: 20,043,379 (GRCm39) Q22K probably benign Het
Diaph3 A T 14: 87,222,306 (GRCm39) W404R probably damaging Het
Dnajb13 T G 7: 100,160,030 (GRCm39) E69A probably damaging Het
Dzip1l A G 9: 99,549,705 (GRCm39) E725G probably damaging Het
Dzip3 T A 16: 48,774,117 (GRCm39) K373* probably null Het
Fmn1 C T 2: 113,195,266 (GRCm39) T322I unknown Het
Gbp9 T C 5: 105,233,028 (GRCm39) Y208C probably benign Het
Gtf2i T A 5: 134,289,425 (GRCm39) K418N probably damaging Het
Herc3 C T 6: 58,832,745 (GRCm39) Q137* probably null Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Iqcm A T 8: 76,472,914 (GRCm39) D251V probably damaging Het
Itpr3 A T 17: 27,308,885 (GRCm39) I363F possibly damaging Het
Khnyn A T 14: 56,124,660 (GRCm39) K305* probably null Het
Klf17 A G 4: 117,617,856 (GRCm39) V167A possibly damaging Het
Letm2 T C 8: 26,071,795 (GRCm39) D369G probably benign Het
Lrrc31 A G 3: 30,744,085 (GRCm39) V141A possibly damaging Het
Msh5 A T 17: 35,261,164 (GRCm39) probably null Het
Neb G A 2: 52,113,224 (GRCm39) probably benign Het
Or10j5 T A 1: 172,785,009 (GRCm39) S216T possibly damaging Het
Or2t6 A T 14: 14,175,593 (GRCm38) M163K probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Padi6 T C 4: 140,469,191 (GRCm39) I50V probably benign Het
Pcdhb22 G T 18: 37,652,179 (GRCm39) G216C probably damaging Het
Ppy A G 11: 101,991,525 (GRCm39) Y5H probably benign Het
Ptov1 A G 7: 44,515,026 (GRCm39) I195T possibly damaging Het
Rassf10 C A 7: 112,553,631 (GRCm39) D77E probably benign Het
Slc25a45 T C 19: 5,934,490 (GRCm39) S153P possibly damaging Het
Slco1a5 G A 6: 142,204,791 (GRCm39) R126C probably damaging Het
Srebf2 T C 15: 82,061,652 (GRCm39) V366A probably benign Het
St6galnac5 T C 3: 152,686,772 (GRCm39) S61G probably benign Het
Sult6b1 A T 17: 79,213,005 (GRCm39) V82D probably benign Het
Tep1 A T 14: 51,088,084 (GRCm39) C818S possibly damaging Het
Tex15 T G 8: 34,072,638 (GRCm39) F2728L possibly damaging Het
Tm9sf2 T A 14: 122,382,558 (GRCm39) F190Y probably damaging Het
Tmem175 T C 5: 108,794,298 (GRCm39) L476P probably damaging Het
Tmprss11c T C 5: 86,385,689 (GRCm39) K248R probably benign Het
Tnk2 T A 16: 32,489,668 (GRCm39) F316I probably damaging Het
Vmn2r75 T A 7: 85,813,372 (GRCm39) M477L probably benign Het
Vmn2r83 A C 10: 79,314,921 (GRCm39) I390L probably benign Het
Vmn2r88 A G 14: 51,648,603 (GRCm39) Y49C probably damaging Het
Zdhhc4 T A 5: 143,302,377 (GRCm39) I318F probably damaging Het
Zmat4 A T 8: 24,238,457 (GRCm39) D27V probably damaging Het
Other mutations in Psmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Psmc1 APN 12 100,079,337 (GRCm39) missense probably damaging 1.00
IGL02445:Psmc1 APN 12 100,081,087 (GRCm39) splice site probably benign
IGL02605:Psmc1 APN 12 100,085,386 (GRCm39) missense probably damaging 1.00
R0018:Psmc1 UTSW 12 100,082,951 (GRCm39) splice site probably benign
R0018:Psmc1 UTSW 12 100,082,951 (GRCm39) splice site probably benign
R0427:Psmc1 UTSW 12 100,085,487 (GRCm39) missense probably damaging 0.96
R0534:Psmc1 UTSW 12 100,086,389 (GRCm39) missense possibly damaging 0.79
R0931:Psmc1 UTSW 12 100,085,341 (GRCm39) missense probably damaging 0.99
R1937:Psmc1 UTSW 12 100,081,102 (GRCm39) missense probably benign 0.26
R2405:Psmc1 UTSW 12 100,086,362 (GRCm39) missense probably benign 0.03
R5293:Psmc1 UTSW 12 100,081,731 (GRCm39) missense probably benign 0.11
R5346:Psmc1 UTSW 12 100,086,359 (GRCm39) missense probably damaging 0.99
R5542:Psmc1 UTSW 12 100,086,399 (GRCm39) critical splice donor site probably null
R7513:Psmc1 UTSW 12 100,081,773 (GRCm39) missense probably benign 0.19
R7993:Psmc1 UTSW 12 100,081,824 (GRCm39) missense probably benign 0.01
R8489:Psmc1 UTSW 12 100,089,356 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATAGCCAGGAGTACACAC -3'
(R):5'- GAACATACTCCTACCGGGCTTC -3'

Sequencing Primer
(F):5'- CACACAGCAAGTTATTCTCTGG -3'
(R):5'- ACCGGGCTTCCTTATAGGC -3'
Posted On 2016-06-06