Incidental Mutation 'R5063:Tm9sf2'
ID386768
Institutional Source Beutler Lab
Gene Symbol Tm9sf2
Ensembl Gene ENSMUSG00000025544
Gene Nametransmembrane 9 superfamily member 2
SynonymsD14Ertd64e, P76, 1500001N15Rik
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R5063 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location122107038-122159604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122145146 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 190 (F190Y)
Ref Sequence ENSEMBL: ENSMUSP00000131227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026624] [ENSMUST00000171318]
Predicted Effect probably damaging
Transcript: ENSMUST00000026624
AA Change: F355Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026624
Gene: ENSMUSG00000025544
AA Change: F355Y

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 74 619 4.5e-209 PFAM
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171318
AA Change: F190Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131227
Gene: ENSMUSG00000025544
AA Change: F190Y

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 73 112 5.9e-9 PFAM
Pfam:EMP70 109 455 1e-172 PFAM
transmembrane domain 465 487 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 9 superfamily. The encoded 76 kDa protein localizes to early endosomes in human cells. The encoded protein possesses a conserved and highly hydrophobic C-terminal domain which contains nine transmembrane domains. The protein may play a role in small molecule transport or act as an ion channel. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Anapc1 T C 2: 128,629,549 M1496V possibly damaging Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Casp8 A T 1: 58,844,374 H280L probably damaging Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Cenpe T A 3: 135,270,954 C2441S probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip1l A G 9: 99,667,652 E725G probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Msh5 A T 17: 35,042,188 probably null Het
Neb G A 2: 52,223,212 probably benign Het
Olfr16 T A 1: 172,957,442 S216T possibly damaging Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slc25a45 T C 19: 5,884,462 S153P possibly damaging Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Tm9sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Tm9sf2 APN 14 122143460 missense probably damaging 1.00
IGL01995:Tm9sf2 APN 14 122143471 missense probably benign 0.25
IGL02173:Tm9sf2 APN 14 122143423 missense probably benign 0.13
IGL02249:Tm9sf2 APN 14 122123750 missense probably damaging 1.00
IGL02328:Tm9sf2 APN 14 122143430 missense possibly damaging 0.79
IGL03231:Tm9sf2 APN 14 122141252 missense possibly damaging 0.95
R0367:Tm9sf2 UTSW 14 122155368 missense probably benign 0.06
R1959:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
R2251:Tm9sf2 UTSW 14 122139731 missense probably benign
R2504:Tm9sf2 UTSW 14 122158684 missense probably benign 0.01
R4791:Tm9sf2 UTSW 14 122139650 missense probably benign 0.00
R4795:Tm9sf2 UTSW 14 122149840 splice site probably null
R4851:Tm9sf2 UTSW 14 122141204 missense probably benign 0.00
R5117:Tm9sf2 UTSW 14 122143501 missense probably benign 0.30
R5443:Tm9sf2 UTSW 14 122126195 missense probably damaging 0.97
R5677:Tm9sf2 UTSW 14 122151962 critical splice acceptor site probably null
R5966:Tm9sf2 UTSW 14 122137509 intron probably benign
R6465:Tm9sf2 UTSW 14 122141207 missense probably benign 0.16
R6873:Tm9sf2 UTSW 14 122145113 missense probably damaging 1.00
R7403:Tm9sf2 UTSW 14 122141228 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGGCAGTTTTCCGATGACTG -3'
(R):5'- GTCAGTAAAGCTACTTTTGGGAAGG -3'

Sequencing Primer
(F):5'- CCGATGACTGTAGACTTCAGTAC -3'
(R):5'- GCTACTTTTGGGAAGGAAAACTCC -3'
Posted On2016-06-06