Incidental Mutation 'R5063:Msh5'
ID386774
Institutional Source Beutler Lab
Gene Symbol Msh5
Ensembl Gene ENSMUSG00000007035
Gene NamemutS homolog 5
SynonymsMut5, G7
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5063 (G1)
Quality Score206
Status Not validated
Chromosome17
Chromosomal Location35028605-35046745 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 35042188 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007250] [ENSMUST00000097338] [ENSMUST00000172491] [ENSMUST00000172536] [ENSMUST00000174556] [ENSMUST00000174603]
Predicted Effect probably null
Transcript: ENSMUST00000007250
SMART Domains Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000097338
SMART Domains Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165329
Predicted Effect probably benign
Transcript: ENSMUST00000172491
SMART Domains Protein: ENSMUSP00000133415
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172536
SMART Domains Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
low complexity region 604 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173928
Predicted Effect probably benign
Transcript: ENSMUST00000174556
SMART Domains Protein: ENSMUSP00000134061
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174603
SMART Domains Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 493 1.67e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174741
SMART Domains Protein: ENSMUSP00000133997
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
Blast:MUTSd 106 140 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the MutS family of proteins that play critical roles in DNA mismatch repair and meiotic homologous recombination processes. Mice lacking the encoded protein are viable but sterile, with severe defects in spermatogenesis in males and complete loss of ovarian structures in females. Mutations in a similar gene in humans have been shown to cause common variable immune deficiency (CVID) and immunoglobulin A deficiency. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted chromosome pairing in meiosis I resulting in cell death and sterility. In males, testes size is reduced, and in females, there is a total loss of ovarian structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Anapc1 T C 2: 128,629,549 M1496V possibly damaging Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Casp8 A T 1: 58,844,374 H280L probably damaging Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Cenpe T A 3: 135,270,954 C2441S probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip1l A G 9: 99,667,652 E725G probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Neb G A 2: 52,223,212 probably benign Het
Olfr16 T A 1: 172,957,442 S216T possibly damaging Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slc25a45 T C 19: 5,884,462 S153P possibly damaging Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tm9sf2 T A 14: 122,145,146 F190Y probably damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Msh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Msh5 APN 17 35029881 nonsense probably null
IGL00491:Msh5 APN 17 35030730 missense probably damaging 0.96
IGL01364:Msh5 APN 17 35028769 missense possibly damaging 0.70
R0189:Msh5 UTSW 17 35029654 missense probably null 0.97
R0257:Msh5 UTSW 17 35032864 missense probably damaging 0.99
R0346:Msh5 UTSW 17 35029888 missense probably benign 0.09
R0449:Msh5 UTSW 17 35041482 missense probably benign 0.09
R0645:Msh5 UTSW 17 35039223 missense probably damaging 1.00
R1925:Msh5 UTSW 17 35029952 missense probably benign 0.00
R1929:Msh5 UTSW 17 35044390 missense probably benign 0.24
R1970:Msh5 UTSW 17 35033600 missense probably damaging 0.99
R2025:Msh5 UTSW 17 35032792 missense possibly damaging 0.90
R2038:Msh5 UTSW 17 35046040 missense probably benign 0.12
R2058:Msh5 UTSW 17 35029756 missense probably damaging 0.99
R2271:Msh5 UTSW 17 35044390 missense probably benign 0.24
R2408:Msh5 UTSW 17 35045119 missense probably damaging 1.00
R3079:Msh5 UTSW 17 35046232 missense probably benign 0.41
R4409:Msh5 UTSW 17 35039250 missense probably damaging 0.98
R4513:Msh5 UTSW 17 35030688 missense possibly damaging 0.89
R4878:Msh5 UTSW 17 35038456 missense probably damaging 1.00
R4951:Msh5 UTSW 17 35038420 nonsense probably null
R5037:Msh5 UTSW 17 35032393 missense possibly damaging 0.80
R5064:Msh5 UTSW 17 35043783 intron probably benign
R5103:Msh5 UTSW 17 35029239 missense possibly damaging 0.96
R5872:Msh5 UTSW 17 35029652 critical splice donor site probably null
R6320:Msh5 UTSW 17 35029924 missense probably damaging 0.97
R6869:Msh5 UTSW 17 35041834 intron probably null
R6997:Msh5 UTSW 17 35030002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGCAATGTCAGTAAGCC -3'
(R):5'- GTTCACCTGCATACAAATATGTGC -3'

Sequencing Primer
(F):5'- CTGGCAATGTCAGTAAGCCAGAAG -3'
(R):5'- TTTAATCCCAGCACTGAGAGG -3'
Posted On2016-06-06