Incidental Mutation 'R5074:Spag17'
ID386799
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 042663-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R5074 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100080118 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1575 (Y1575N)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119906
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: Y1575N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Y1575N

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,833 H143Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Ccdc114 T A 7: 45,929,090 M29K probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc25a T A 9: 109,884,140 C227S possibly damaging Het
Ces1a A G 8: 93,032,675 S278P possibly damaging Het
Cfap65 A T 1: 74,922,978 S695T probably benign Het
Col13a1 A G 10: 61,874,018 silent Het
Ctps A T 4: 120,553,973 L282Q probably damaging Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Dennd3 G A 15: 73,547,295 R645H probably damaging Het
Dnaaf5 G T 5: 139,174,207 R620L probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Dnah9 A G 11: 65,850,040 F4107L probably damaging Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dst A C 1: 34,295,263 K4857N probably damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Enpep T A 3: 129,303,755 Q409L probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hsd3b3 T C 3: 98,742,024 T328A possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Itga10 C T 3: 96,652,211 Q475* probably null Het
Itga6 T A 2: 71,826,435 D344E probably benign Het
Kcnmb4 T C 10: 116,473,197 T109A probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Lrrc66 G A 5: 73,608,011 P563L probably damaging Het
Mamdc2 T C 19: 23,378,796 D96G probably benign Het
Map3k12 A T 15: 102,501,832 probably null Het
Mc3r A T 2: 172,249,613 I252F possibly damaging Het
Metrn C T 17: 25,796,639 G34D probably damaging Het
Mipep A G 14: 60,809,013 E328G probably benign Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Myh8 A T 11: 67,305,916 T1792S possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo5a T A 9: 75,174,156 S1008T probably benign Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Nup210 T A 6: 91,055,327 I20F probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1335 A C 4: 118,808,860 W319G possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr675 A T 7: 105,024,053 M309K probably benign Het
Olfr763 T C 10: 129,011,344 Y20H possibly damaging Het
Olfr871 A T 9: 20,212,582 I78F possibly damaging Het
Papolg G A 11: 23,867,331 T153I possibly damaging Het
Pappa A G 4: 65,205,128 H900R probably benign Het
Pcdh17 T C 14: 84,533,342 S1087P probably benign Het
Phf11a T G 14: 59,284,400 L107F possibly damaging Het
Phlpp2 A T 8: 109,925,829 I602F probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prkaa1 G T 15: 5,176,911 R416L possibly damaging Het
Prkdc C A 16: 15,772,048 R2592S probably damaging Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prodh A T 16: 18,077,789 probably null Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Riox2 T C 16: 59,491,873 S458P possibly damaging Het
Rnase4 T C 14: 51,105,245 V142A possibly damaging Het
Rnf138 A G 18: 21,026,147 N244S probably benign Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Sfxn4 C T 19: 60,851,012 V203M probably damaging Het
Skor2 G T 18: 76,858,954 E124* probably null Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
St8sia4 G A 1: 95,667,185 A26V probably benign Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tgm1 A G 14: 55,709,935 V323A probably damaging Het
Tmco4 A G 4: 139,058,122 H501R probably damaging Het
Tob1 A T 11: 94,213,741 R34S possibly damaging Het
Trhr2 C T 8: 122,357,371 V297I probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Trpm3 T C 19: 22,885,349 V485A possibly damaging Het
Trrap T C 5: 144,851,179 I3518T probably damaging Het
Ttc27 T C 17: 74,747,755 L352P probably damaging Het
Ush1g A G 11: 115,318,297 L357P possibly damaging Het
Usp24 A G 4: 106,420,447 H2258R probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Vdr A G 15: 97,857,578 S355P probably benign Het
Vldlr T C 19: 27,238,277 S184P probably damaging Het
Xpo4 C A 14: 57,584,641 A1073S probably benign Het
Zfand2b A G 1: 75,170,990 D224G probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGTCCTTCAGAAACATCATGTTC -3'
(R):5'- CATTTCAAAACAAAGCTGTGGC -3'

Sequencing Primer
(F):5'- CTCAAATCCCTCAAATTGCA -3'
(R):5'- GAAGCTCAATCTAGGCCCAGTG -3'
Posted On2016-06-06