Incidental Mutation 'R5075:Atf7ip'
ID386924
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Nameactivating transcription factor 7 interacting protein
SynonymsMcaf1, 2610204M12Rik, AM, ATFa-associated Modulator
MMRRC Submission 042664-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R5075 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136506167-136610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136560234 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000140502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335] [ENSMUST00000185724] [ENSMUST00000186577] [ENSMUST00000186742] [ENSMUST00000187429] [ENSMUST00000189535] [ENSMUST00000203988]
Predicted Effect probably benign
Transcript: ENSMUST00000032335
AA Change: D155G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: D155G

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185724
AA Change: D155G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140458
Gene: ENSMUSG00000030213
AA Change: D155G

DomainStartEndE-ValueType
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186577
SMART Domains Protein: ENSMUSP00000140121
Gene: ENSMUSG00000030213

DomainStartEndE-ValueType
coiled coil region 71 101 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186742
Predicted Effect probably benign
Transcript: ENSMUST00000187429
AA Change: D163G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140502
Gene: ENSMUSG00000030213
AA Change: D163G

DomainStartEndE-ValueType
internal_repeat_1 123 144 8.96e-5 PROSPERO
internal_repeat_1 143 164 8.96e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
coiled coil region 666 696 N/A INTRINSIC
low complexity region 701 711 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 774 803 N/A INTRINSIC
low complexity region 864 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189535
Predicted Effect probably benign
Transcript: ENSMUST00000203178
Predicted Effect probably benign
Transcript: ENSMUST00000203988
SMART Domains Protein: ENSMUSP00000145022
Gene: ENSMUSG00000030213

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 3 73 1.6e-26 PFAM
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,052 K1016E probably damaging Het
Agl A G 3: 116,793,807 F33S probably damaging Het
Cep85 C A 4: 134,132,367 D662Y probably damaging Het
Cntn6 T A 6: 104,833,030 S558T probably damaging Het
Dnah8 T C 17: 30,739,757 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnah8 T A 17: 30,800,531 N3859K probably damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Esm1 A G 13: 113,213,358 Y104C probably damaging Het
Fkbp15 T C 4: 62,321,029 K613R probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,158,963 probably benign Het
Hdac4 A G 1: 91,996,120 S223P probably benign Het
Hypk A G 2: 121,455,630 probably benign Het
Kpna1 T A 16: 36,009,352 F70I probably damaging Het
Lrp2 A G 2: 69,465,758 Y3336H probably benign Het
Mettl7b A G 10: 128,960,680 F87L probably damaging Het
Mier1 A G 4: 103,139,473 D99G probably benign Het
Muc4 T C 16: 32,754,794 probably benign Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1480 T A 19: 13,530,273 M244K probably benign Het
Peg3 A T 7: 6,708,420 C1268S probably damaging Het
Recql4 G A 15: 76,709,544 P122L probably damaging Het
Rex2 A T 4: 147,057,694 Q213L possibly damaging Het
Rnf25 A G 1: 74,595,644 V73A probably benign Het
Sacm1l A G 9: 123,582,262 D372G probably benign Het
Selplg T C 5: 113,819,984 D87G probably benign Het
Sgsh G A 11: 119,346,768 T340M probably benign Het
Slc4a3 A T 1: 75,557,368 I1120F probably damaging Het
Snrnp40 T C 4: 130,388,582 Y311H probably benign Het
Stard7 A T 2: 127,269,959 probably benign Het
Stat1 A T 1: 52,122,712 K40M possibly damaging Het
Sun1 T C 5: 139,226,891 probably null Het
Tet2 T A 3: 133,486,906 Q589L probably benign Het
Tmc7 A T 7: 118,552,696 probably null Het
Unc79 A T 12: 103,074,954 I749F possibly damaging Het
Ust A G 10: 8,518,224 F59S probably damaging Het
Wdr81 A T 11: 75,452,481 D653E probably benign Het
Zfat A G 15: 68,180,230 S572P probably benign Het
Zmynd15 G C 11: 70,462,120 E143D probably damaging Het
Zzef1 A G 11: 72,858,344 E886G probably damaging Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136560681 missense probably benign 0.00
IGL01483:Atf7ip APN 6 136587459 missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136606720 missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136593118 missense probably benign 0.01
IGL02547:Atf7ip APN 6 136603276 splice site probably benign
IGL02869:Atf7ip APN 6 136606579 missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136560688 missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136606727 missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136605382 missense possibly damaging 0.79
R0024:Atf7ip UTSW 6 136599820 splice site probably benign
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136560989 missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136561163 missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136560012 missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136609192 unclassified probably benign
R0526:Atf7ip UTSW 6 136559805 missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136606867 missense probably damaging 0.96
R1663:Atf7ip UTSW 6 136603324 missense possibly damaging 0.93
R1793:Atf7ip UTSW 6 136609219 unclassified probably benign
R1822:Atf7ip UTSW 6 136587260 missense probably benign 0.11
R1873:Atf7ip UTSW 6 136559888 missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136560780 missense probably benign 0.41
R2059:Atf7ip UTSW 6 136609348 unclassified probably benign
R2134:Atf7ip UTSW 6 136605487 missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136566651 missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136575324 unclassified probably benign
R3755:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3756:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3890:Atf7ip UTSW 6 136587045 missense possibly damaging 0.48
R4190:Atf7ip UTSW 6 136587501 missense probably damaging 1.00
R4494:Atf7ip UTSW 6 136563749 splice site probably null
R4588:Atf7ip UTSW 6 136599694 missense probably benign
R4618:Atf7ip UTSW 6 136565106 missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136561194 missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136596491 missense probably benign 0.06
R4922:Atf7ip UTSW 6 136560041 missense possibly damaging 0.91
R4956:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4957:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136582428 missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136561388 missense probably damaging 0.99
R5279:Atf7ip UTSW 6 136603379 nonsense probably null
R5445:Atf7ip UTSW 6 136587257 missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136606814 missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136566787 critical splice donor site probably null
R5891:Atf7ip UTSW 6 136559977 missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136571502 missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136559819 missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136582391 missense probably damaging 1.00
R6880:Atf7ip UTSW 6 136561040 missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136559757 splice site probably null
R7075:Atf7ip UTSW 6 136596515 critical splice donor site probably null
R7308:Atf7ip UTSW 6 136565089 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCCCTTGTATGCCCAATG -3'
(R):5'- GGCGGCTTCTTCAGAAACAG -3'

Sequencing Primer
(F):5'- CTTGTATGCCCAATGTTGCTG -3'
(R):5'- GGCTTCTTCAGAAACAGGATCTC -3'
Posted On2016-06-06