Incidental Mutation 'R5075:Ust'
ID386931
Institutional Source Beutler Lab
Gene Symbol Ust
Ensembl Gene ENSMUSG00000047712
Gene Nameuronyl-2-sulfotransferase
SynonymsUA2OST, D930010O20Rik
MMRRC Submission 042664-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5075 (G1)
Quality Score220
Status Validated
Chromosome10
Chromosomal Location8204756-8518825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8518224 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 59 (F59S)
Ref Sequence ENSEMBL: ENSMUSP00000052017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061601]
Predicted Effect probably damaging
Transcript: ENSMUST00000061601
AA Change: F59S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052017
Gene: ENSMUSG00000047712
AA Change: F59S

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 53 317 8.5e-11 PFAM
Pfam:Sulfotransfer_2 98 359 6.4e-38 PFAM
low complexity region 385 398 N/A INTRINSIC
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,052 K1016E probably damaging Het
Agl A G 3: 116,793,807 F33S probably damaging Het
Atf7ip A G 6: 136,560,234 D163G probably benign Het
Cep85 C A 4: 134,132,367 D662Y probably damaging Het
Cntn6 T A 6: 104,833,030 S558T probably damaging Het
Dnah8 T C 17: 30,739,757 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnah8 T A 17: 30,800,531 N3859K probably damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Esm1 A G 13: 113,213,358 Y104C probably damaging Het
Fkbp15 T C 4: 62,321,029 K613R probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,158,963 probably benign Het
Hdac4 A G 1: 91,996,120 S223P probably benign Het
Hypk A G 2: 121,455,630 probably benign Het
Kpna1 T A 16: 36,009,352 F70I probably damaging Het
Lrp2 A G 2: 69,465,758 Y3336H probably benign Het
Mettl7b A G 10: 128,960,680 F87L probably damaging Het
Mier1 A G 4: 103,139,473 D99G probably benign Het
Muc4 T C 16: 32,754,794 probably benign Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1480 T A 19: 13,530,273 M244K probably benign Het
Peg3 A T 7: 6,708,420 C1268S probably damaging Het
Recql4 G A 15: 76,709,544 P122L probably damaging Het
Rex2 A T 4: 147,057,694 Q213L possibly damaging Het
Rnf25 A G 1: 74,595,644 V73A probably benign Het
Sacm1l A G 9: 123,582,262 D372G probably benign Het
Selplg T C 5: 113,819,984 D87G probably benign Het
Sgsh G A 11: 119,346,768 T340M probably benign Het
Slc4a3 A T 1: 75,557,368 I1120F probably damaging Het
Snrnp40 T C 4: 130,388,582 Y311H probably benign Het
Stard7 A T 2: 127,269,959 probably benign Het
Stat1 A T 1: 52,122,712 K40M possibly damaging Het
Sun1 T C 5: 139,226,891 probably null Het
Tet2 T A 3: 133,486,906 Q589L probably benign Het
Tmc7 A T 7: 118,552,696 probably null Het
Unc79 A T 12: 103,074,954 I749F possibly damaging Het
Wdr81 A T 11: 75,452,481 D653E probably benign Het
Zfat A G 15: 68,180,230 S572P probably benign Het
Zmynd15 G C 11: 70,462,120 E143D probably damaging Het
Zzef1 A G 11: 72,858,344 E886G probably damaging Het
Other mutations in Ust
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Ust APN 10 8298078 missense probably benign 0.09
IGL03056:Ust APN 10 8207562 missense probably benign 0.01
R0015:Ust UTSW 10 8330065 splice site probably benign
R0417:Ust UTSW 10 8245936 missense probably damaging 1.00
R0423:Ust UTSW 10 8298148 missense probably damaging 1.00
R0533:Ust UTSW 10 8248080 splice site probably benign
R1344:Ust UTSW 10 8298190 missense possibly damaging 0.82
R1436:Ust UTSW 10 8307438 missense probably damaging 1.00
R1803:Ust UTSW 10 8298055 critical splice donor site probably null
R2059:Ust UTSW 10 8207566 missense probably damaging 1.00
R4248:Ust UTSW 10 8518218 missense possibly damaging 0.67
R4811:Ust UTSW 10 8245941 missense probably damaging 0.97
R5912:Ust UTSW 10 8298061 missense probably benign 0.25
R5950:Ust UTSW 10 8248101 missense probably benign 0.33
R7302:Ust UTSW 10 8518209 missense probably damaging 0.99
R7478:Ust UTSW 10 8390886 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGAGTACTGTAGGAAGCAG -3'
(R):5'- AAGACGAGCAGAGTACCCTG -3'

Sequencing Primer
(F):5'- CTGAGGGATGCTCAGTGGC -3'
(R):5'- TCTCCATGTGCAGACAGCC -3'
Posted On2016-06-06