Incidental Mutation 'R5078:Cerkl'
ID386948
Institutional Source Beutler Lab
Gene Symbol Cerkl
Ensembl Gene ENSMUSG00000075256
Gene Nameceramide kinase-like
SynonymsRp26
MMRRC Submission 042667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5078 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79330543-79456785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79393008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 123 (D123V)
Ref Sequence ENSEMBL: ENSMUSP00000114325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143974]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143602
Predicted Effect probably benign
Transcript: ENSMUST00000143974
AA Change: D123V

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114325
Gene: ENSMUSG00000075256
AA Change: D123V

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Pfam:DAGK_cat 152 293 2.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153602
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit retinal apoptosis and decreased amplitudes and increased implicit time of oscillatory potentials. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,323,907 S345G probably benign Het
Adgrf2 A T 17: 42,710,986 F316I probably damaging Het
Ank2 A G 3: 126,942,353 probably benign Het
Auts2 T C 5: 132,258,947 K66E possibly damaging Het
Bicra T C 7: 15,975,457 D1144G probably damaging Het
Cabin1 A G 10: 75,721,478 S1109P probably damaging Het
Camkv T C 9: 107,945,373 V29A probably damaging Het
Ccdc178 A T 18: 22,067,628 probably null Het
Ccser1 G A 6: 61,311,366 R171H probably damaging Het
Cdk19 A G 10: 40,436,154 Y133C probably damaging Het
Chd1 T C 17: 15,726,354 S121P possibly damaging Het
Col4a2 T C 8: 11,443,936 V1459A probably benign Het
Dlg1 T A 16: 31,856,469 Y704* probably null Het
Dsg2 T C 18: 20,596,083 probably null Het
Egln3 T C 12: 54,181,667 R218G probably damaging Het
Gm11568 T C 11: 99,858,355 C129R unknown Het
Gm13991 T C 2: 116,527,874 noncoding transcript Het
Gmnc C A 16: 26,965,582 V58L probably benign Het
Gpx5 A G 13: 21,288,711 F151S probably damaging Het
Helz G A 11: 107,656,096 G1079R probably damaging Het
Ice1 T C 13: 70,604,850 E1039G probably benign Het
Kif18a T C 2: 109,295,142 probably benign Het
Klhl29 T C 12: 5,093,530 T500A possibly damaging Het
Lrfn5 A C 12: 61,843,874 K650Q possibly damaging Het
Lrp2 T C 2: 69,501,530 D1627G possibly damaging Het
Nxn T C 11: 76,261,607 K354E probably damaging Het
Olfr1165-ps T A 2: 88,101,535 I151L probably benign Het
Pcnx2 T C 8: 125,752,156 T2118A probably benign Het
Phldb2 A G 16: 45,777,742 F861L possibly damaging Het
Piezo2 A G 18: 63,024,536 Y2368H probably damaging Het
Pnp T A 14: 50,951,506 L252* probably null Het
Prom2 T C 2: 127,531,837 Q641R probably benign Het
Prpf31 T C 7: 3,634,703 S180P possibly damaging Het
Prss27 C A 17: 24,044,440 Y142* probably null Het
Ripk1 T G 13: 34,017,099 M265R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ropn1 T A 16: 34,666,791 D32E probably damaging Het
Rps23 T C 13: 90,923,703 F41L probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Selenot C T 3: 58,585,271 R60W probably damaging Het
Tll1 T C 8: 64,093,887 K342E probably damaging Het
Tlx1 A T 19: 45,156,021 N61Y probably damaging Het
Vmn2r117 T A 17: 23,460,148 I701F probably damaging Het
Zmynd12 A G 4: 119,444,850 K229E probably damaging Het
Other mutations in Cerkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Cerkl APN 2 79341499 missense probably benign 0.00
IGL01330:Cerkl APN 2 79368781 missense possibly damaging 0.90
IGL01468:Cerkl APN 2 79343215 critical splice donor site probably null
IGL01946:Cerkl APN 2 79393020 missense probably benign 0.19
IGL02027:Cerkl APN 2 79341286 unclassified probably benign
IGL02809:Cerkl APN 2 79342202 missense possibly damaging 0.54
IGL03293:Cerkl APN 2 79342375 missense probably damaging 0.98
R0076:Cerkl UTSW 2 79343289 missense possibly damaging 0.93
R0453:Cerkl UTSW 2 79342451 missense probably benign 0.25
R0918:Cerkl UTSW 2 79333629 missense probably benign 0.00
R1533:Cerkl UTSW 2 79341357 missense possibly damaging 0.94
R4003:Cerkl UTSW 2 79428794 missense possibly damaging 0.86
R5093:Cerkl UTSW 2 79333523 missense probably damaging 1.00
R5431:Cerkl UTSW 2 79341335 missense probably damaging 1.00
R5522:Cerkl UTSW 2 79392984 missense probably benign 0.44
R6249:Cerkl UTSW 2 79368778 missense probably damaging 1.00
R7036:Cerkl UTSW 2 79341378 missense probably benign 0.03
R7201:Cerkl UTSW 2 79333590 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGAAAAGTAACTTGCGGG -3'
(R):5'- TTCTTCTTAGGTGGCACCAG -3'

Sequencing Primer
(F):5'- GAGCCACTAAGTGCTGAGTCTTC -3'
(R):5'- TGGCACCAGGCATGATCTG -3'
Posted On2016-06-06