Incidental Mutation 'R5079:Stam'
ID386998
Institutional Source Beutler Lab
Gene Symbol Stam
Ensembl Gene ENSMUSG00000026718
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 1
SynonymsSTAM1
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14074098-14149634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14074539 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 8 (M8T)
Ref Sequence ENSEMBL: ENSMUSP00000121228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028050] [ENSMUST00000102960] [ENSMUST00000138989] [ENSMUST00000193636]
Predicted Effect probably benign
Transcript: ENSMUST00000028050
SMART Domains Protein: ENSMUSP00000028050
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
PDB:3F1I|C 301 377 9e-46 PDB
low complexity region 387 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102960
SMART Domains Protein: ENSMUSP00000100025
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
Pfam:GAT 304 377 6.8e-10 PFAM
low complexity region 387 404 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138989
AA Change: M8T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121228
Gene: ENSMUSG00000026718
AA Change: M8T

DomainStartEndE-ValueType
VHS 4 136 1.76e-59 SMART
UIM 168 187 1.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156901
Predicted Effect probably benign
Transcript: ENSMUST00000193636
SMART Domains Protein: ENSMUSP00000141207
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
Pfam:VHS 5 44 2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194771
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-transducing adaptor molecule family. These proteins mediate downstream signaling of cytokine receptors and also play a role in ER to Golgi trafficking by interacting with the coat protein II complex. The encoded protein also associates with hepatocyte growth factor-regulated substrate to form the endosomal sorting complex required for transport-0 (ESCRT-0), which sorts ubiquitinated membrane proteins to the ESCRT-1 complex for lysosomal degradation. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive growth retardation, priapism, male infertility, degeneration of hippocapal CA3 pyramidal neurons and premature death, but exhibit normal lymphocyte development, proliferation and responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Stam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Stam APN 2 14115968 intron probably benign
IGL02964:Stam APN 2 14115968 intron probably benign
IGL03365:Stam APN 2 14146390 nonsense probably null
R0058:Stam UTSW 2 14138141 missense probably damaging 1.00
R0410:Stam UTSW 2 14138991 missense probably benign 0.04
R0479:Stam UTSW 2 14117495 missense probably damaging 1.00
R1018:Stam UTSW 2 14117374 splice site probably benign
R1554:Stam UTSW 2 14141828 missense probably benign
R1631:Stam UTSW 2 14146248 nonsense probably null
R1897:Stam UTSW 2 14129026 missense probably damaging 1.00
R3735:Stam UTSW 2 14129012 missense probably damaging 1.00
R3973:Stam UTSW 2 14138961 missense probably damaging 1.00
R4610:Stam UTSW 2 14115858 missense probably damaging 1.00
R4914:Stam UTSW 2 14102416 missense probably damaging 1.00
R5209:Stam UTSW 2 14146347 missense probably benign 0.04
R5574:Stam UTSW 2 14115864 missense probably damaging 1.00
R5636:Stam UTSW 2 14117427 missense probably damaging 1.00
R6968:Stam UTSW 2 14116018 missense probably damaging 1.00
Z1088:Stam UTSW 2 14139090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGATGTTGGTAAGTGTTTTCAC -3'
(R):5'- GGGCCAGGCAAATACTTTGG -3'

Sequencing Primer
(F):5'- GTGTTTTCACCGCCCCC -3'
(R):5'- GGCGATAGAGCATATAATCAATCTGC -3'
Posted On2016-06-06