Mutagenetix > Incidental Mutations

Incidental Mutation 'R5079:Ggta1'

386999

Institutional Source

Beutler Lab

Gene Symbol

Ggta1

Ensembl Gene

ENSMUSG00000035778

Gene Name

glycoprotein galactosyltransferase alpha 1, 3

Synonyms

Ggta, glycoprotein alpha galactosyl transferase 1, GALT, Gal, Ggta-1, alpha3GalT, alpha Gal

MMRRC Submission

042668-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35400179-35463231 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35422237 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 43 (I43T)

Ref Sequence

ENSEMBL: ENSMUSP00000115112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044255] [ENSMUST00000079424] [ENSMUST00000102794] [ENSMUST00000113001] [ENSMUST00000113002] [ENSMUST00000131745] [ENSMUST00000164889]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044255
AA Change: I43T

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000049408
Gene: ENSMUSG00000035778
AA Change: I43T

Domain	Start	End	E-Value	Type
transmembrane domain	42	60	N/A	INTRINSIC
Pfam:Glyco_transf_6	81	404	1.2e-165	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079424
AA Change: I43T

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000078393
Gene: ENSMUSG00000035778
AA Change: I43T

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_6	34	370	5.5e-177	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102794
AA Change: I43T

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099858
Gene: ENSMUSG00000035778
AA Change: I43T

Domain	Start	End	E-Value	Type
transmembrane domain	42	60	N/A	INTRINSIC
Pfam:Glyco_transf_6	74	404	4.3e-182	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113001
AA Change: I43T

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108625
Gene: ENSMUSG00000035778
AA Change: I43T

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_6	45	382	3.6e-177	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113002
AA Change: I43T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108626
Gene: ENSMUSG00000035778
AA Change: I43T

Domain	Start	End	E-Value	Type
transmembrane domain	42	60	N/A	INTRINSIC
Pfam:Glyco_transf_6	62	392	3.6e-182	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130913

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131745
AA Change: I43T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115112
Gene: ENSMUSG00000035778
AA Change: I43T

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_6	34	140	1.5e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164889
AA Change: I43T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132408
Gene: ENSMUSG00000035778
AA Change: I43T

Domain	Start	End	E-Value	Type
transmembrane domain	42	60	N/A	INTRINSIC
Pfam:Glyco_transf_6	62	392	3.6e-182	PFAM

Meta Mutation Damage Score

0.0412

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.6%

Validation Efficiency

90% (63/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the galactosyltransferase family of intracellular, membrane-bound enzymes that are involved in the biosynthesis of glycoproteins and glycolipids. The encoded protein catalyzes the transfer of galactose from UDP-galactose to N-acetyllactosamine in an alpha(1,3) linkage to form galactose alpha(1,3)-galactose. Mice lacking the encoded protein develop cortical cataracts. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display defects in humoral immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,737,330	S221G	probably benign	Het
Abca9	A	T	11: 110,145,569	F571L	possibly damaging	Het
Agbl4	T	A	4: 111,566,629	M284K	possibly damaging	Het
Ankrd16	A	G	2: 11,778,899	D104G	probably damaging	Het
Bpifc	T	C	10: 85,981,304	D230G	probably damaging	Het
Casc3	C	T	11: 98,810,426		probably benign	Het
Catsperd	T	C	17: 56,658,153		probably null	Het
Cpxm2	C	T	7: 132,154,285		probably null	Het
Crisp1	A	T	17: 40,308,976		probably null	Het
Crybg2	T	C	4: 134,074,253	I908T	possibly damaging	Het
Csn3	T	C	5: 87,929,767	V44A	possibly damaging	Het
Dopey1	T	A	9: 86,487,421	D102E	probably damaging	Het
Etfdh	T	C	3: 79,618,398	Y111C	probably damaging	Het
Fam69c	A	T	18: 84,730,577	H100L	probably benign	Het
Fat3	T	C	9: 15,999,127	S1860G	probably benign	Het
Gba2	G	T	4: 43,568,640		probably benign	Het
Glb1l2	T	C	9: 26,771,109	I149V	probably benign	Het
Gm5084	T	A	13: 60,212,825		noncoding transcript	Het
Gm5591	G	T	7: 38,522,136	P170T	probably benign	Het
Gm6614	A	C	6: 141,972,347	I601R	probably benign	Het
Gucy2d	A	T	7: 98,458,268		probably null	Het
Itpr3	T	C	17: 27,098,423	F851L	probably damaging	Het
Kat2b	T	A	17: 53,663,638	I684N	probably damaging	Het
Klra17	C	A	6: 129,872,196	K138N	possibly damaging	Het
Lrrc4	T	A	6: 28,830,770	H282L	possibly damaging	Het
Lyst	T	C	13: 13,757,353	I3522T	probably benign	Het
Man2c1	A	G	9: 57,136,716	T312A	probably damaging	Het
Mapkbp1	A	G	2: 120,013,733	R313G	probably damaging	Het
N4bp2	G	A	5: 65,811,977	G1361R	probably damaging	Het
Nbas	A	T	12: 13,374,711	I984F	probably damaging	Het
Ncor1	T	A	11: 62,345,237	Q579L	possibly damaging	Het
Nme9	A	G	9: 99,459,702	Y35C	probably damaging	Het
Olfr1136	C	A	2: 87,693,208	V225F	probably damaging	Het
Ormdl1	T	C	1: 53,308,934	V145A	probably damaging	Het
Paxbp1	C	A	16: 91,025,146		probably null	Het
Pcnx	C	A	12: 81,979,089	S1530*	probably null	Het
Pogk	A	G	1: 166,399,164	W473R	probably damaging	Het
Pot1b	A	T	17: 55,669,801	S374T	probably benign	Het
Rcn1	A	G	2: 105,399,057	F50S	probably damaging	Het
Rcvrn	T	A	11: 67,702,941	I186N	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ror1	T	A	4: 100,441,422	I664N	probably damaging	Het
Sall2	G	T	14: 52,314,754	A326E	probably damaging	Het
Sh2d6	G	A	6: 72,519,850	P66S	probably benign	Het
Slc6a20b	T	A	9: 123,598,498	S449C	probably damaging	Het
Slc9a3	A	T	13: 74,164,287	N668Y	probably damaging	Het
Sorcs2	T	G	5: 36,043,452	K584T	probably damaging	Het
Stam	T	C	2: 14,074,539	M8T	probably benign	Het
Styk1	G	A	6: 131,301,713	P333S	probably damaging	Het
Sycp1	A	G	3: 102,878,800	C589R	possibly damaging	Het
Tas2r123	A	G	6: 132,847,718	I193V	probably benign	Het
Tnks1bp1	C	A	2: 85,062,626	Q304K	probably damaging	Het
Traf3ip2	T	C	10: 39,626,477	L207P	probably damaging	Het
Usp49	A	G	17: 47,673,221	S384G	possibly damaging	Het
Vezt	T	C	10: 94,020,624		probably null	Het
Vmn1r87	C	A	7: 13,132,326	M11I	probably benign	Het
Vmn2r39	A	G	7: 9,023,490	V504A	probably benign	Het
Wapl	G	A	14: 34,724,757	A607T	probably damaging	Het
Zfp638	A	G	6: 83,929,456	N201S	probably benign	Het

Other mutations in Ggta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01366:Ggta1	APN	2	35402450	nonsense	probably null
IGL01903:Ggta1	APN	2	35402557	missense	possibly damaging	0.74
IGL02796:Ggta1	APN	2	35413317	splice site	probably benign
IGL02799:Ggta1	UTSW	2	35422199	missense	probably damaging	0.98
R0383:Ggta1	UTSW	2	35402404	missense	probably damaging	1.00
R1430:Ggta1	UTSW	2	35408017	missense	possibly damaging	0.81
R1667:Ggta1	UTSW	2	35414283	missense	possibly damaging	0.83
R1672:Ggta1	UTSW	2	35402133	nonsense	probably null
R2246:Ggta1	UTSW	2	35402109	makesense	probably null
R3149:Ggta1	UTSW	2	35402623	missense	probably damaging	1.00
R3683:Ggta1	UTSW	2	35407988	missense	probably benign	0.39
R3684:Ggta1	UTSW	2	35407988	missense	probably benign	0.39
R3685:Ggta1	UTSW	2	35407988	missense	probably benign	0.39
R4812:Ggta1	UTSW	2	35402723	missense	probably benign	0.01
R4856:Ggta1	UTSW	2	35402791	missense	possibly damaging	0.59
R5756:Ggta1	UTSW	2	35402383	missense	probably damaging	1.00
R6279:Ggta1	UTSW	2	35407994	missense	probably damaging	1.00
R6651:Ggta1	UTSW	2	35402294	missense	probably benign	0.00
R6967:Ggta1	UTSW	2	35402722	missense	possibly damaging	0.91
X0010:Ggta1	UTSW	2	35402719	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGACTGGACTCCTGCTCAC -3'
(R):5'- GCTGAGTGAGTTACAAATGTATCC -3'

Sequencing Primer
(F):5'- GACTCCTGCTCACGGCTC -3'
(R):5'- CACCTGTGAGCTGCAAATGTG -3'

Posted On

2016-06-06