Incidental Mutation 'R5079:Ggta1'
ID386999
Institutional Source Beutler Lab
Gene Symbol Ggta1
Ensembl Gene ENSMUSG00000035778
Gene Nameglycoprotein galactosyltransferase alpha 1, 3
SynonymsGgta, glycoprotein alpha galactosyl transferase 1, GALT, Gal, Ggta-1, alpha3GalT, alpha Gal
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35400179-35463231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35422237 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 43 (I43T)
Ref Sequence ENSEMBL: ENSMUSP00000115112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044255] [ENSMUST00000079424] [ENSMUST00000102794] [ENSMUST00000113001] [ENSMUST00000113002] [ENSMUST00000131745] [ENSMUST00000164889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044255
AA Change: I43T

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049408
Gene: ENSMUSG00000035778
AA Change: I43T

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 81 404 1.2e-165 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079424
AA Change: I43T

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078393
Gene: ENSMUSG00000035778
AA Change: I43T

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 370 5.5e-177 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102794
AA Change: I43T

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099858
Gene: ENSMUSG00000035778
AA Change: I43T

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 74 404 4.3e-182 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113001
AA Change: I43T

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108625
Gene: ENSMUSG00000035778
AA Change: I43T

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 45 382 3.6e-177 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113002
AA Change: I43T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108626
Gene: ENSMUSG00000035778
AA Change: I43T

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130913
Predicted Effect possibly damaging
Transcript: ENSMUST00000131745
AA Change: I43T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115112
Gene: ENSMUSG00000035778
AA Change: I43T

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 140 1.5e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164889
AA Change: I43T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132408
Gene: ENSMUSG00000035778
AA Change: I43T

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Meta Mutation Damage Score 0.0412 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: This gene encodes a member of the galactosyltransferase family of intracellular, membrane-bound enzymes that are involved in the biosynthesis of glycoproteins and glycolipids. The encoded protein catalyzes the transfer of galactose from UDP-galactose to N-acetyllactosamine in an alpha(1,3) linkage to form galactose alpha(1,3)-galactose. Mice lacking the encoded protein develop cortical cataracts. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display defects in humoral immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Ggta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ggta1 APN 2 35402450 nonsense probably null
IGL01903:Ggta1 APN 2 35402557 missense possibly damaging 0.74
IGL02796:Ggta1 APN 2 35413317 splice site probably benign
IGL02799:Ggta1 UTSW 2 35422199 missense probably damaging 0.98
R0383:Ggta1 UTSW 2 35402404 missense probably damaging 1.00
R1430:Ggta1 UTSW 2 35408017 missense possibly damaging 0.81
R1667:Ggta1 UTSW 2 35414283 missense possibly damaging 0.83
R1672:Ggta1 UTSW 2 35402133 nonsense probably null
R2246:Ggta1 UTSW 2 35402109 makesense probably null
R3149:Ggta1 UTSW 2 35402623 missense probably damaging 1.00
R3683:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3684:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3685:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R4812:Ggta1 UTSW 2 35402723 missense probably benign 0.01
R4856:Ggta1 UTSW 2 35402791 missense possibly damaging 0.59
R5756:Ggta1 UTSW 2 35402383 missense probably damaging 1.00
R6279:Ggta1 UTSW 2 35407994 missense probably damaging 1.00
R6651:Ggta1 UTSW 2 35402294 missense probably benign 0.00
R6967:Ggta1 UTSW 2 35402722 missense possibly damaging 0.91
X0010:Ggta1 UTSW 2 35402719 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGACTGGACTCCTGCTCAC -3'
(R):5'- GCTGAGTGAGTTACAAATGTATCC -3'

Sequencing Primer
(F):5'- GACTCCTGCTCACGGCTC -3'
(R):5'- CACCTGTGAGCTGCAAATGTG -3'
Posted On2016-06-06