Incidental Mutation 'R5079:Gba2'
ID387008
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Nameglucosidase beta 2
Synonymsbile acid
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43566928-43578873 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 43568640 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably benign
Transcript: ENSMUST00000030189
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Predicted Effect probably benign
Transcript: ENSMUST00000167751
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43568477 missense probably damaging 1.00
IGL01577:Gba2 APN 4 43573753 nonsense probably null
IGL02066:Gba2 APN 4 43570175 missense probably benign 0.18
IGL02126:Gba2 APN 4 43567918 critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43568719 missense probably benign 0.13
IGL02474:Gba2 APN 4 43568538 missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43567281 missense probably benign
IGL02628:Gba2 APN 4 43568919 missense probably benign 0.01
IGL02706:Gba2 APN 4 43567257 missense probably benign 0.01
IGL02795:Gba2 APN 4 43578331 missense probably damaging 1.00
R0389:Gba2 UTSW 4 43570832 missense probably damaging 1.00
R0555:Gba2 UTSW 4 43569927 missense probably damaging 1.00
R0650:Gba2 UTSW 4 43570424 unclassified probably null
R1603:Gba2 UTSW 4 43567823 missense probably damaging 1.00
R1628:Gba2 UTSW 4 43570118 missense probably benign 0.00
R1664:Gba2 UTSW 4 43578080 missense probably benign 0.01
R1686:Gba2 UTSW 4 43573869 splice site probably benign
R1730:Gba2 UTSW 4 43578242 missense probably benign 0.01
R2036:Gba2 UTSW 4 43568118 unclassified probably benign
R2061:Gba2 UTSW 4 43574029 nonsense probably null
R2259:Gba2 UTSW 4 43570107 missense probably benign
R2847:Gba2 UTSW 4 43568000 unclassified probably null
R3026:Gba2 UTSW 4 43578308 missense possibly damaging 0.95
R3617:Gba2 UTSW 4 43573803 missense probably damaging 1.00
R4225:Gba2 UTSW 4 43569464 unclassified probably benign
R4346:Gba2 UTSW 4 43571337 missense probably benign 0.04
R4601:Gba2 UTSW 4 43573810 missense probably damaging 1.00
R4611:Gba2 UTSW 4 43568092 missense probably damaging 1.00
R4664:Gba2 UTSW 4 43568619 unclassified probably benign
R4784:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R4785:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R5327:Gba2 UTSW 4 43574063 missense probably damaging 1.00
R5746:Gba2 UTSW 4 43568465 unclassified probably null
R6052:Gba2 UTSW 4 43568330 missense probably damaging 1.00
R6485:Gba2 UTSW 4 43574118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGCATCATAGGTCTGG -3'
(R):5'- TATCCTGTCCACTGACACACTG -3'

Sequencing Primer
(F):5'- CATGCATCATAGGTCTGGTCTGC -3'
(R):5'- TGAACCAGGTCCCCTCC -3'
Posted On2016-06-06