Incidental Mutation 'R5079:Crybg2'
ID387011
Institutional Source Beutler Lab
Gene Symbol Crybg2
Ensembl Gene ENSMUSG00000012123
Gene Namecrystallin beta-gamma domain containing 2
SynonymsAim1l
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134060815-134092504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134074253 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 908 (I908T)
Ref Sequence ENSEMBL: ENSMUSP00000154159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121391] [ENSMUST00000137053] [ENSMUST00000149956] [ENSMUST00000219402] [ENSMUST00000227683]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121391
AA Change: I599T

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114099
Gene: ENSMUSG00000012123
AA Change: I599T

DomainStartEndE-ValueType
low complexity region 171 205 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
low complexity region 414 443 N/A INTRINSIC
low complexity region 560 582 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
coiled coil region 683 703 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
XTALbg 842 921 2.56e-7 SMART
XTALbg 929 1010 9.33e-10 SMART
XTALbg 1024 1110 5.06e-29 SMART
XTALbg 1118 1199 1.4e-22 SMART
XTALbg 1212 1291 2.22e-16 SMART
XTALbg 1299 1379 1.69e-16 SMART
RICIN 1383 1514 7.89e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149504
Predicted Effect probably benign
Transcript: ENSMUST00000149956
SMART Domains Protein: ENSMUSP00000123349
Gene: ENSMUSG00000012123

DomainStartEndE-ValueType
XTALbg 1 60 1.39e-2 SMART
XTALbg 62 148 3.99e-27 SMART
XTALbg 156 237 1.4e-22 SMART
XTALbg 250 293 7.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219402
Predicted Effect possibly damaging
Transcript: ENSMUST00000227683
AA Change: I908T

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Crybg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Crybg2 APN 4 134075444 missense possibly damaging 0.57
IGL01147:Crybg2 APN 4 134089264 splice site probably null
IGL02003:Crybg2 APN 4 134072456 missense probably benign
IGL02468:Crybg2 APN 4 134082587 missense probably damaging 1.00
R0089:Crybg2 UTSW 4 134081194 missense probably damaging 1.00
R0414:Crybg2 UTSW 4 134072636 small deletion probably benign
R0579:Crybg2 UTSW 4 134072738 missense probably damaging 0.97
R0634:Crybg2 UTSW 4 134075304 splice site probably benign
R0638:Crybg2 UTSW 4 134074454 missense probably damaging 1.00
R0686:Crybg2 UTSW 4 134074526 small deletion probably benign
R1583:Crybg2 UTSW 4 134081459 missense probably damaging 1.00
R1651:Crybg2 UTSW 4 134074825 missense possibly damaging 0.84
R1651:Crybg2 UTSW 4 134074903 missense probably benign 0.07
R1752:Crybg2 UTSW 4 134073650 missense probably damaging 0.96
R1883:Crybg2 UTSW 4 134074283 nonsense probably null
R1903:Crybg2 UTSW 4 134078856 missense probably damaging 1.00
R2042:Crybg2 UTSW 4 134087533 missense possibly damaging 0.89
R2081:Crybg2 UTSW 4 134088820 missense possibly damaging 0.82
R2229:Crybg2 UTSW 4 134074526 small deletion probably benign
R2321:Crybg2 UTSW 4 134074511 missense probably benign 0.38
R2392:Crybg2 UTSW 4 134072614 missense probably benign 0.01
R2939:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R2940:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R3028:Crybg2 UTSW 4 134073784 missense probably benign 0.19
R4458:Crybg2 UTSW 4 134074894 missense probably benign 0.32
R4487:Crybg2 UTSW 4 134074201 missense probably benign 0.00
R4680:Crybg2 UTSW 4 134072718 frame shift probably null
R4681:Crybg2 UTSW 4 134072718 frame shift probably null
R4682:Crybg2 UTSW 4 134072718 frame shift probably null
R4766:Crybg2 UTSW 4 134089352 missense probably damaging 1.00
R5291:Crybg2 UTSW 4 134073427 missense probably benign 0.00
R5453:Crybg2 UTSW 4 134078836 critical splice acceptor site probably null
R5711:Crybg2 UTSW 4 134082627 missense probably damaging 0.97
R5834:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R5969:Crybg2 UTSW 4 134075692 splice site probably null
R5976:Crybg2 UTSW 4 134074526 small deletion probably benign
R6022:Crybg2 UTSW 4 134074273 nonsense probably null
R6046:Crybg2 UTSW 4 134092077 missense probably damaging 1.00
R6088:Crybg2 UTSW 4 134075790 unclassified probably null
R6196:Crybg2 UTSW 4 134081139 missense probably damaging 0.99
R6246:Crybg2 UTSW 4 134089346 missense probably damaging 0.96
R6303:Crybg2 UTSW 4 134087587 missense possibly damaging 0.66
R6320:Crybg2 UTSW 4 134081426 missense probably damaging 1.00
R6354:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R6737:Crybg2 UTSW 4 134072690 missense probably damaging 0.99
R6744:Crybg2 UTSW 4 134088896 missense probably damaging 1.00
R6847:Crybg2 UTSW 4 134065546 missense probably benign 0.40
R6891:Crybg2 UTSW 4 134081837 missense probably benign 0.32
X0064:Crybg2 UTSW 4 134089276 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAAAGAGACTGTTGAAAGCCC -3'
(R):5'- TGGCGTACATAGCCAGGTAG -3'

Sequencing Primer
(F):5'- GACTGTTGAAAGCCCCACCTTC -3'
(R):5'- CGTACATAGCCAGGTAGGAGGAAC -3'
Posted On2016-06-06