Incidental Mutation 'R5079:Klra17'
ID387019
Institutional Source Beutler Lab
Gene Symbol Klra17
Ensembl Gene ENSMUSG00000014543
Gene Namekiller cell lectin-like receptor, subfamily A, member 17
SynonymsLy49q1, Ly-49Q, Ly49Q
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.030) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129831154-129876672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129872196 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 138 (K138N)
Ref Sequence ENSEMBL: ENSMUSP00000114108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014687] [ENSMUST00000122219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014687
AA Change: K138N

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014687
Gene: ENSMUSG00000014543
AA Change: K138N

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
Blast:CLECT 73 126 2e-12 BLAST
CLECT 144 259 1.5e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122219
AA Change: K138N

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114108
Gene: ENSMUSG00000014543
AA Change: K138N

DomainStartEndE-ValueType
low complexity region 53 70 N/A INTRINSIC
Blast:CLECT 74 127 2e-12 BLAST
CLECT 145 260 1.5e-14 SMART
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit reduced plasmacytoid dendritic cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Klra17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Klra17 APN 6 129831509 missense probably benign 0.12
IGL02084:Klra17 APN 6 129831593 missense probably damaging 1.00
IGL02995:Klra17 APN 6 129868684 critical splice donor site probably null
IGL03238:Klra17 APN 6 129868810 missense probably benign 0.43
R0118:Klra17 UTSW 6 129831589 missense probably benign 0.01
R0583:Klra17 UTSW 6 129868693 missense probably damaging 1.00
R1103:Klra17 UTSW 6 129868843 unclassified probably benign
R1378:Klra17 UTSW 6 129865684 missense probably damaging 0.96
R1513:Klra17 UTSW 6 129872314 missense possibly damaging 0.61
R1817:Klra17 UTSW 6 129868718 unclassified probably null
R2262:Klra17 UTSW 6 129874794 critical splice donor site probably null
R2446:Klra17 UTSW 6 129831514 missense probably benign 0.02
R2484:Klra17 UTSW 6 129868757 missense probably damaging 1.00
R3410:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3411:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3739:Klra17 UTSW 6 129873365 missense probably benign 0.03
R4747:Klra17 UTSW 6 129872269 missense probably damaging 0.97
R4956:Klra17 UTSW 6 129873316 missense probably damaging 1.00
R5310:Klra17 UTSW 6 129868708 missense probably damaging 1.00
R5366:Klra17 UTSW 6 129874895 missense possibly damaging 0.89
R5875:Klra17 UTSW 6 129874828 missense probably benign 0.01
R6043:Klra17 UTSW 6 129872187 critical splice donor site probably null
R6515:Klra17 UTSW 6 129831499 missense probably damaging 1.00
R6675:Klra17 UTSW 6 129872323 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCCAGGGAGTAGTAAGAGTACC -3'
(R):5'- TCTAAACTGCCACCATAACTGTAG -3'

Sequencing Primer
(F):5'- TTCTCCTAATGCAAACACAGACTTC -3'
(R):5'- GCCACCATAACTGTAGCACCATG -3'
Posted On2016-06-06