Incidental Mutation 'R5079:Styk1'
ID387020
Institutional Source Beutler Lab
Gene Symbol Styk1
Ensembl Gene ENSMUSG00000032899
Gene Nameserine/threonine/tyrosine kinase 1
Synonyms
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131299142-131353597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131301713 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 333 (P333S)
Ref Sequence ENSEMBL: ENSMUSP00000044098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049150] [ENSMUST00000121078]
Predicted Effect probably damaging
Transcript: ENSMUST00000049150
AA Change: P333S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044098
Gene: ENSMUSG00000032899
AA Change: P333S

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Pkinase 119 387 3.2e-31 PFAM
Pfam:Pkinase_Tyr 119 387 1.8e-59 PFAM
low complexity region 399 410 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121078
AA Change: P244S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112900
Gene: ENSMUSG00000032899
AA Change: P244S

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 298 2.5e-53 PFAM
Pfam:Pkinase 68 298 5.7e-29 PFAM
low complexity region 310 321 N/A INTRINSIC
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor protein tyrosine kinases, like STYK1, play important roles in diverse cellular and developmental processes, such as cell proliferation, differentiation, and survival (Liu et al., 2004 [PubMed 15150103]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Styk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Styk1 APN 6 131301662 missense possibly damaging 0.75
IGL01370:Styk1 APN 6 131301652 missense probably damaging 1.00
IGL01833:Styk1 APN 6 131302366 splice site probably benign
IGL02705:Styk1 APN 6 131312583 missense probably benign 0.02
IGL03029:Styk1 APN 6 131300560 missense probably benign 0.27
R0201:Styk1 UTSW 6 131301730 splice site probably benign
R2267:Styk1 UTSW 6 131312576 missense probably benign 0.01
R2268:Styk1 UTSW 6 131312576 missense probably benign 0.01
R2269:Styk1 UTSW 6 131312576 missense probably benign 0.01
R2919:Styk1 UTSW 6 131313004 start gained probably benign
R3153:Styk1 UTSW 6 131310012 nonsense probably null
R3154:Styk1 UTSW 6 131310012 nonsense probably null
R4041:Styk1 UTSW 6 131312917 critical splice donor site probably null
R4650:Styk1 UTSW 6 131300569 missense probably damaging 1.00
R4739:Styk1 UTSW 6 131300466 missense probably damaging 1.00
R5497:Styk1 UTSW 6 131304707 missense probably damaging 0.97
R5637:Styk1 UTSW 6 131300418 missense possibly damaging 0.82
R6137:Styk1 UTSW 6 131311016 missense probably damaging 1.00
R6429:Styk1 UTSW 6 131310064 missense possibly damaging 0.93
X0021:Styk1 UTSW 6 131307069 critical splice donor site probably null
X0026:Styk1 UTSW 6 131310939 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTGAGGCACATTTAAAGGGG -3'
(R):5'- ACTTTGCTTAAACCTCAGGATCTCC -3'

Sequencing Primer
(F):5'- GTGTGGTTAAGTAGGGAACACACC -3'
(R):5'- ACATTACCTTTGTTCTCCAAAACAC -3'
Posted On2016-06-06