Incidental Mutation 'R5079:Vezt'
ID387037
Institutional Source Beutler Lab
Gene Symbol Vezt
Ensembl Gene ENSMUSG00000036099
Gene Namevezatin, adherens junctions transmembrane protein
Synonyms
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93939165-94035817 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 94020624 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047711] [ENSMUST00000118077] [ENSMUST00000118205] [ENSMUST00000119818] [ENSMUST00000123201] [ENSMUST00000150344] [ENSMUST00000150704]
Predicted Effect probably benign
Transcript: ENSMUST00000047711
SMART Domains Protein: ENSMUSP00000037955
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1.6e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
low complexity region 702 715 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118077
SMART Domains Protein: ENSMUSP00000113983
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 9.2e-61 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118205
SMART Domains Protein: ENSMUSP00000113321
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119818
SMART Domains Protein: ENSMUSP00000113715
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 150 442 1e-93 PFAM
low complexity region 570 585 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 768 783 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123201
SMART Domains Protein: ENSMUSP00000114550
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 120 190 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132735
Predicted Effect probably null
Transcript: ENSMUST00000150344
SMART Domains Protein: ENSMUSP00000122561
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150704
SMART Domains Protein: ENSMUSP00000121727
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 256 1.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154267
Meta Mutation Damage Score 0.6296 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is essential for the formation of adherens junctions. It is required for both the pre-implantation morphogenesis of a blastocyst and for the implantation process. The encoded protein is also a component of the ankle-link complex in cochlear hair cells, where it may effect resilience to sound trauma. It is also thought to be involved in dendritic spine morphogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele develop to the blastocyst stage inducing a decidual response but die at implantation. Only about half of blastocysts are able to hatch upon in vitro culture and mutant outgrowths show severe defects in intercellular adhesion and signs of cellular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Vezt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Vezt APN 10 93996857 missense probably damaging 1.00
IGL01655:Vezt APN 10 93996997 missense probably benign 0.00
IGL02014:Vezt APN 10 93996949 missense probably benign 0.35
IGL03072:Vezt APN 10 93974033 missense probably damaging 1.00
R0542:Vezt UTSW 10 94007096 critical splice acceptor site probably null
R1633:Vezt UTSW 10 93984276 missense probably damaging 1.00
R1757:Vezt UTSW 10 93970563 missense probably benign
R1808:Vezt UTSW 10 93990164 missense probably damaging 1.00
R4296:Vezt UTSW 10 93973931 small deletion probably benign
R4972:Vezt UTSW 10 94000350 critical splice donor site probably null
R5137:Vezt UTSW 10 93970510 missense probably benign 0.00
R5319:Vezt UTSW 10 93970331 missense probably benign
R5743:Vezt UTSW 10 93997095 missense probably benign 0.01
R6002:Vezt UTSW 10 94000474 missense probably damaging 1.00
R6281:Vezt UTSW 10 93973946 missense probably benign 0.04
R6652:Vezt UTSW 10 93970279 missense probably damaging 1.00
R6681:Vezt UTSW 10 93996997 missense probably benign 0.00
R6914:Vezt UTSW 10 93970451 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTTCAACTCTTAAAGCACTTG -3'
(R):5'- GCTTAGTAATGACAGACACGC -3'

Sequencing Primer
(F):5'- ATCATAGGCTAGTATCCTGCAAG -3'
(R):5'- TTAGTAATGACAGACACGCCCTCC -3'
Posted On2016-06-06