Incidental Mutation 'R5079:Pcnx'
ID387043
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 81979089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 1530 (S1530*)
Ref Sequence ENSEMBL: ENSMUSP00000152104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably null
Transcript: ENSMUST00000021567
AA Change: S1536*
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: S1536*

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000221675
AA Change: S897*
Predicted Effect probably null
Transcript: ENSMUST00000221721
AA Change: S1530*
Predicted Effect probably benign
Transcript: ENSMUST00000222005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222908
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Paxbp1 C A 16: 91,025,146 probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGTACTGAAGTCTGTGCTGC -3'
(R):5'- TACAGTGGATATGCTCTAAGTCAC -3'

Sequencing Primer
(F):5'- TGCCACGCTGACGATTGTC -3'
(R):5'- GCATTTCACTGTTCAAAGCCAGG -3'
Posted On2016-06-06