Incidental Mutation 'R5079:Paxbp1'
ID387049
Institutional Source Beutler Lab
Gene Symbol Paxbp1
Ensembl Gene ENSMUSG00000022974
Gene NamePAX3 and PAX7 binding protein 1
Synonyms
MMRRC Submission 042668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5079 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91014037-91044543 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 91025146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118522] [ENSMUST00000145136]
Predicted Effect probably benign
Transcript: ENSMUST00000023698
SMART Domains Protein: ENSMUSP00000023698
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 60 86 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 434 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118522
SMART Domains Protein: ENSMUSP00000113835
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
coiled coil region 3 28 N/A INTRINSIC
low complexity region 114 120 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
Pfam:GCFC 597 812 5.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128922
Predicted Effect probably benign
Transcript: ENSMUST00000145136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146281
Meta Mutation Damage Score 0.734 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may bind to GC-rich DNA sequences, which suggests its involvement in the regulation of transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,330 S221G probably benign Het
Abca9 A T 11: 110,145,569 F571L possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Ankrd16 A G 2: 11,778,899 D104G probably damaging Het
Bpifc T C 10: 85,981,304 D230G probably damaging Het
Casc3 C T 11: 98,810,426 probably benign Het
Catsperd T C 17: 56,658,153 probably null Het
Cpxm2 C T 7: 132,154,285 probably null Het
Crisp1 A T 17: 40,308,976 probably null Het
Crybg2 T C 4: 134,074,253 I908T possibly damaging Het
Csn3 T C 5: 87,929,767 V44A possibly damaging Het
Dopey1 T A 9: 86,487,421 D102E probably damaging Het
Etfdh T C 3: 79,618,398 Y111C probably damaging Het
Fam69c A T 18: 84,730,577 H100L probably benign Het
Fat3 T C 9: 15,999,127 S1860G probably benign Het
Gba2 G T 4: 43,568,640 probably benign Het
Ggta1 A G 2: 35,422,237 I43T possibly damaging Het
Glb1l2 T C 9: 26,771,109 I149V probably benign Het
Gm5084 T A 13: 60,212,825 noncoding transcript Het
Gm5591 G T 7: 38,522,136 P170T probably benign Het
Gm6614 A C 6: 141,972,347 I601R probably benign Het
Gucy2d A T 7: 98,458,268 probably null Het
Itpr3 T C 17: 27,098,423 F851L probably damaging Het
Kat2b T A 17: 53,663,638 I684N probably damaging Het
Klra17 C A 6: 129,872,196 K138N possibly damaging Het
Lrrc4 T A 6: 28,830,770 H282L possibly damaging Het
Lyst T C 13: 13,757,353 I3522T probably benign Het
Man2c1 A G 9: 57,136,716 T312A probably damaging Het
Mapkbp1 A G 2: 120,013,733 R313G probably damaging Het
N4bp2 G A 5: 65,811,977 G1361R probably damaging Het
Nbas A T 12: 13,374,711 I984F probably damaging Het
Ncor1 T A 11: 62,345,237 Q579L possibly damaging Het
Nme9 A G 9: 99,459,702 Y35C probably damaging Het
Olfr1136 C A 2: 87,693,208 V225F probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Pcnx C A 12: 81,979,089 S1530* probably null Het
Pogk A G 1: 166,399,164 W473R probably damaging Het
Pot1b A T 17: 55,669,801 S374T probably benign Het
Rcn1 A G 2: 105,399,057 F50S probably damaging Het
Rcvrn T A 11: 67,702,941 I186N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 T A 4: 100,441,422 I664N probably damaging Het
Sall2 G T 14: 52,314,754 A326E probably damaging Het
Sh2d6 G A 6: 72,519,850 P66S probably benign Het
Slc6a20b T A 9: 123,598,498 S449C probably damaging Het
Slc9a3 A T 13: 74,164,287 N668Y probably damaging Het
Sorcs2 T G 5: 36,043,452 K584T probably damaging Het
Stam T C 2: 14,074,539 M8T probably benign Het
Styk1 G A 6: 131,301,713 P333S probably damaging Het
Sycp1 A G 3: 102,878,800 C589R possibly damaging Het
Tas2r123 A G 6: 132,847,718 I193V probably benign Het
Tnks1bp1 C A 2: 85,062,626 Q304K probably damaging Het
Traf3ip2 T C 10: 39,626,477 L207P probably damaging Het
Usp49 A G 17: 47,673,221 S384G possibly damaging Het
Vezt T C 10: 94,020,624 probably null Het
Vmn1r87 C A 7: 13,132,326 M11I probably benign Het
Vmn2r39 A G 7: 9,023,490 V504A probably benign Het
Wapl G A 14: 34,724,757 A607T probably damaging Het
Zfp638 A G 6: 83,929,456 N201S probably benign Het
Other mutations in Paxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Paxbp1 APN 16 91035916 splice site probably benign
IGL01705:Paxbp1 APN 16 91016988 missense probably benign 0.01
IGL02418:Paxbp1 APN 16 91034112 missense probably damaging 1.00
IGL02527:Paxbp1 APN 16 91037273 missense possibly damaging 0.57
IGL02661:Paxbp1 APN 16 91030525 missense probably benign 0.43
IGL02796:Paxbp1 APN 16 91025294 unclassified probably benign
IGL03336:Paxbp1 APN 16 91034172 missense probably benign
R0016:Paxbp1 UTSW 16 91036036 splice site probably benign
R0306:Paxbp1 UTSW 16 91022115 missense possibly damaging 0.54
R0331:Paxbp1 UTSW 16 91037367 missense possibly damaging 0.95
R0724:Paxbp1 UTSW 16 91036536 missense probably damaging 1.00
R0944:Paxbp1 UTSW 16 91023427 missense probably benign 0.25
R1348:Paxbp1 UTSW 16 91035016 missense probably damaging 0.97
R1909:Paxbp1 UTSW 16 91044305 unclassified probably benign
R2234:Paxbp1 UTSW 16 91034934 missense probably benign 0.05
R3156:Paxbp1 UTSW 16 91035990 missense probably benign 0.00
R3819:Paxbp1 UTSW 16 91022752 unclassified probably benign
R3910:Paxbp1 UTSW 16 91042681 missense probably damaging 1.00
R3949:Paxbp1 UTSW 16 91044017 missense probably damaging 1.00
R4109:Paxbp1 UTSW 16 91016898 missense probably benign 0.10
R4577:Paxbp1 UTSW 16 91015154 missense probably damaging 1.00
R4584:Paxbp1 UTSW 16 91034123 missense probably damaging 1.00
R4596:Paxbp1 UTSW 16 91030547 missense probably benign 0.28
R4837:Paxbp1 UTSW 16 91034978 nonsense probably null
R4877:Paxbp1 UTSW 16 91044311 unclassified probably benign
R5086:Paxbp1 UTSW 16 91015216 unclassified probably benign
R5167:Paxbp1 UTSW 16 91022667 critical splice donor site probably null
R5291:Paxbp1 UTSW 16 91044352 start codon destroyed probably null
R5322:Paxbp1 UTSW 16 91015162 missense probably benign 0.01
R5529:Paxbp1 UTSW 16 91030513 missense possibly damaging 0.62
R5662:Paxbp1 UTSW 16 91037397 missense probably benign 0.45
R5814:Paxbp1 UTSW 16 91030496 missense probably damaging 1.00
R6422:Paxbp1 UTSW 16 91023444 missense probably benign 0.07
R7225:Paxbp1 UTSW 16 91027068 missense probably damaging 1.00
X0026:Paxbp1 UTSW 16 91027242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTACTGCTCCAAGTATAGGTCCC -3'
(R):5'- CTCTCCTCCAAAAGTTGTAAGTG -3'

Sequencing Primer
(F):5'- CTGTAAAGTGGCCTTCAAGC -3'
(R):5'- CCTCCAAAAGTTGTAAGTGTTTGAG -3'
Posted On2016-06-06