Incidental Mutation 'R5080:Carf'
ID387058
Institutional Source Beutler Lab
Gene Symbol Carf
Ensembl Gene ENSMUSG00000026017
Gene Namecalcium response factor
SynonymsAls2cr8
MMRRC Submission 042669-MU
Accession Numbers

Genbank: NM_139150; MGI: 2182269

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60098247-60153953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60150613 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 631 (Q631K)
Ref Sequence ENSEMBL: ENSMUSP00000027171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027171] [ENSMUST00000130075] [ENSMUST00000180952] [ENSMUST00000186107] [ENSMUST00000187978]
Predicted Effect probably damaging
Transcript: ENSMUST00000027171
AA Change: Q631K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027171
Gene: ENSMUSG00000026017
AA Change: Q631K

DomainStartEndE-ValueType
Pfam:ALS2CR8 227 457 6.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130075
Predicted Effect probably benign
Transcript: ENSMUST00000132949
Predicted Effect probably benign
Transcript: ENSMUST00000180952
AA Change: Q666K

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137825
Gene: ENSMUSG00000026017
AA Change: Q666K

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186107
SMART Domains Protein: ENSMUSP00000139554
Gene: ENSMUSG00000026017

DomainStartEndE-ValueType
low complexity region 239 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187978
AA Change: Q666K

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141169
Gene: ENSMUSG00000026017
AA Change: Q666K

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have aberrant learning and memory. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Carf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Carf APN 1 60124842 splice site probably benign
IGL00730:Carf APN 1 60147418 nonsense probably null
IGL00792:Carf APN 1 60126009 missense possibly damaging 0.73
IGL00913:Carf APN 1 60147955 missense probably benign 0.20
IGL01487:Carf APN 1 60109379 missense probably damaging 1.00
IGL02214:Carf APN 1 60148081 missense probably damaging 1.00
IGL03258:Carf APN 1 60109229 missense possibly damaging 0.93
IGL03285:Carf APN 1 60146154 missense probably damaging 1.00
3-1:Carf UTSW 1 60141468 missense possibly damaging 0.93
R0375:Carf UTSW 1 60144002 missense probably damaging 1.00
R0465:Carf UTSW 1 60131983 missense probably damaging 1.00
R0591:Carf UTSW 1 60125914 splice site probably benign
R1158:Carf UTSW 1 60147839 missense probably benign 0.22
R1433:Carf UTSW 1 60124858 missense probably damaging 1.00
R1464:Carf UTSW 1 60125906 splice site probably benign
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1546:Carf UTSW 1 60126036 critical splice donor site probably null
R1801:Carf UTSW 1 60141505 missense possibly damaging 0.60
R1977:Carf UTSW 1 60146136 missense probably damaging 1.00
R2086:Carf UTSW 1 60109411 missense probably damaging 1.00
R2163:Carf UTSW 1 60147486 splice site probably benign
R2198:Carf UTSW 1 60141484 missense probably damaging 1.00
R2238:Carf UTSW 1 60148034 missense probably benign
R2981:Carf UTSW 1 60139232 missense probably damaging 1.00
R4090:Carf UTSW 1 60136347 missense possibly damaging 0.94
R4573:Carf UTSW 1 60148112 missense probably benign 0.39
R4737:Carf UTSW 1 60109318 missense probably benign 0.00
R4906:Carf UTSW 1 60141367 missense probably damaging 1.00
R4965:Carf UTSW 1 60150637 missense probably damaging 0.99
R5184:Carf UTSW 1 60108174 missense probably damaging 0.99
R5949:Carf UTSW 1 60139313 missense probably damaging 1.00
R6135:Carf UTSW 1 60147963 missense probably damaging 1.00
R6346:Carf UTSW 1 60141540 nonsense probably null
R6886:Carf UTSW 1 60136254 splice site probably null
R7115:Carf UTSW 1 60148150 missense not run
Predicted Primers PCR Primer
(F):5'- CAGTGTCACCATGACCCTTTCG -3'
(R):5'- TGGTCCAGTGATTGATACACC -3'

Sequencing Primer
(F):5'- GGGATAACCTTGAATTCCTGATCC -3'
(R):5'- GTCCAGTGATTGATACACCATCTCAG -3'
Posted On2016-06-06