Incidental Mutation 'R5080:Atp1a2'
ID387061
Institutional Source Beutler Lab
Gene Symbol Atp1a2
Ensembl Gene ENSMUSG00000007097
Gene NameATPase, Na+/K+ transporting, alpha 2 polypeptide
SynonymsAtpa-3
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172271709-172298064 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 172284445 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]
Predicted Effect probably benign
Transcript: ENSMUST00000085913
SMART Domains Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 132 363 2.5e-59 PFAM
Pfam:Hydrolase 368 726 4.5e-19 PFAM
Pfam:HAD 371 723 3.2e-18 PFAM
Pfam:Cation_ATPase 424 518 1.9e-25 PFAM
Pfam:Cation_ATPase_C 796 1005 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097464
SMART Domains Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.9e-63 PFAM
Pfam:Hydrolase 368 726 2e-32 PFAM
Pfam:HAD 371 723 1.7e-15 PFAM
Pfam:Hydrolase_like2 424 518 1.3e-26 PFAM
Pfam:Cation_ATPase_C 796 947 3.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137679
SMART Domains Protein: ENSMUSP00000117873
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.2e-63 PFAM
Pfam:Hydrolase 368 613 8.5e-9 PFAM
Pfam:Hydrolase_like2 424 518 5.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155363
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Atp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Atp1a2 APN 1 172276002 missense probably damaging 1.00
IGL00954:Atp1a2 APN 1 172290634 missense probably damaging 1.00
IGL01083:Atp1a2 APN 1 172284619 missense probably benign
IGL01372:Atp1a2 APN 1 172278943 missense probably damaging 1.00
IGL01762:Atp1a2 APN 1 172284913 missense possibly damaging 0.89
IGL01896:Atp1a2 APN 1 172286011 missense probably damaging 1.00
IGL01942:Atp1a2 APN 1 172286309 missense probably benign 0.35
IGL01944:Atp1a2 APN 1 172276187 missense probably damaging 0.98
IGL02219:Atp1a2 APN 1 172279718 missense probably damaging 1.00
IGL02219:Atp1a2 APN 1 172279731 nonsense probably null
IGL02304:Atp1a2 APN 1 172289353 missense probably benign
IGL02507:Atp1a2 APN 1 172285771 missense probably damaging 1.00
IGL02557:Atp1a2 APN 1 172278651 missense possibly damaging 0.83
IGL02632:Atp1a2 APN 1 172280614 missense possibly damaging 0.89
IGL03053:Atp1a2 APN 1 172278356 missense probably damaging 1.00
IGL03104:Atp1a2 APN 1 172293367 missense probably damaging 0.97
IGL03161:Atp1a2 APN 1 172278862 intron probably benign
IGL03218:Atp1a2 APN 1 172289303 missense probably null 0.82
R0121:Atp1a2 UTSW 1 172289342 missense probably damaging 0.99
R0630:Atp1a2 UTSW 1 172291275 missense possibly damaging 0.78
R0682:Atp1a2 UTSW 1 172284597 missense probably benign 0.00
R0755:Atp1a2 UTSW 1 172289381 missense probably benign 0.37
R1413:Atp1a2 UTSW 1 172279344 missense probably damaging 1.00
R1680:Atp1a2 UTSW 1 172278954 missense probably damaging 0.99
R2094:Atp1a2 UTSW 1 172287433 missense probably damaging 1.00
R3714:Atp1a2 UTSW 1 172278984 missense probably damaging 0.96
R4573:Atp1a2 UTSW 1 172278637 missense possibly damaging 0.75
R4928:Atp1a2 UTSW 1 172278387 missense possibly damaging 0.93
R4953:Atp1a2 UTSW 1 172291442 intron probably benign
R5014:Atp1a2 UTSW 1 172284871 missense probably benign 0.05
R5129:Atp1a2 UTSW 1 172275955 missense probably benign 0.02
R5360:Atp1a2 UTSW 1 172278869 critical splice donor site probably null
R5619:Atp1a2 UTSW 1 172279381 missense probably damaging 0.99
R5622:Atp1a2 UTSW 1 172291427 intron probably benign
R5718:Atp1a2 UTSW 1 172279442 missense probably damaging 1.00
R5729:Atp1a2 UTSW 1 172293371 missense probably damaging 0.99
R5909:Atp1a2 UTSW 1 172287230 missense probably damaging 1.00
R6018:Atp1a2 UTSW 1 172298012 intron probably benign
R6145:Atp1a2 UTSW 1 172287238 missense probably damaging 1.00
R6164:Atp1a2 UTSW 1 172278892 missense probably damaging 0.97
R6315:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6317:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6319:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6323:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6324:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6374:Atp1a2 UTSW 1 172289375 missense probably damaging 1.00
R6764:Atp1a2 UTSW 1 172284614 missense probably benign
R6812:Atp1a2 UTSW 1 172284877 missense probably benign 0.20
R7025:Atp1a2 UTSW 1 172284550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTAGGTCTCCATGCCAGG -3'
(R):5'- GAGCTGAACTTTCCCACAGAG -3'

Sequencing Primer
(F):5'- CCGACTGGTGCTTTGAATGAGAC -3'
(R):5'- TGAACTTTCCCACAGAGAAGCTC -3'
Posted On2016-06-06