Incidental Mutation 'R5080:Ifi206'
ID387062
Institutional Source Beutler Lab
Gene Symbol Ifi206
Ensembl Gene ENSMUSG00000037849
Gene Nameinterferon activated gene 206
SynonymsGm4955, Pyblhin-C
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R5080 (G1)
Quality Score197
Status Validated
Chromosome1
Chromosomal Location173468485-173491041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173473848 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 755 (I755F)
Ref Sequence ENSEMBL: ENSMUSP00000134646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160565] [ENSMUST00000169797]
Predicted Effect probably benign
Transcript: ENSMUST00000037976
AA Change: I69F

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133946
Gene: ENSMUSG00000037849
AA Change: I69F

DomainStartEndE-ValueType
Pfam:HIN 18 185 8.3e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160565
AA Change: I755F

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: I755F

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000169797
AA Change: I27F

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133809
Gene: ENSMUSG00000037849
AA Change: I27F

DomainStartEndE-ValueType
Pfam:HIN 1 142 8.8e-66 PFAM
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Ifi206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Ifi206 APN 1 173485576 missense probably benign 0.00
IGL02044:Ifi206 APN 1 173480991 missense probably benign 0.41
IGL02118:Ifi206 APN 1 173481768 missense probably benign 0.05
IGL02476:Ifi206 APN 1 173481566 missense probably benign 0.02
IGL02824:Ifi206 APN 1 173481872 missense possibly damaging 0.95
IGL03375:Ifi206 APN 1 173480778 missense probably benign 0.06
PIT4142001:Ifi206 UTSW 1 173481164 missense probably benign 0.02
R0069:Ifi206 UTSW 1 173486847 missense probably damaging 1.00
R0741:Ifi206 UTSW 1 173473749 missense probably benign 0.41
R1572:Ifi206 UTSW 1 173486853 missense probably benign 0.10
R1742:Ifi206 UTSW 1 173481971 missense probably benign 0.06
R4109:Ifi206 UTSW 1 173480988 missense probably benign 0.00
R4707:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4783:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4785:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4805:Ifi206 UTSW 1 173481386 missense possibly damaging 0.55
R4918:Ifi206 UTSW 1 173482044 missense possibly damaging 0.73
R5043:Ifi206 UTSW 1 173486718 missense probably damaging 1.00
R5419:Ifi206 UTSW 1 173481231 missense probably benign 0.05
R5420:Ifi206 UTSW 1 173481033 missense possibly damaging 0.84
R5777:Ifi206 UTSW 1 173481362 missense possibly damaging 0.55
R5988:Ifi206 UTSW 1 173481340 missense possibly damaging 0.90
R6772:Ifi206 UTSW 1 173481207 missense unknown
R6782:Ifi206 UTSW 1 173481357 missense unknown
R6806:Ifi206 UTSW 1 173481571 missense probably benign 0.06
R7042:Ifi206 UTSW 1 173481242 missense
R7091:Ifi206 UTSW 1 173473875 missense not run
X0052:Ifi206 UTSW 1 173481969 missense possibly damaging 0.89
Z1088:Ifi206 UTSW 1 173474011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATCTGGGGTTGCAAATG -3'
(R):5'- CTGAAGAAAATGGTCACCAGC -3'

Sequencing Primer
(F):5'- AATGTTCCATTCACAAATGTTCCTGC -3'
(R):5'- CCAGCAAGGTTTCAAACAAGTG -3'
Posted On2016-06-06