Incidental Mutation 'R5080:Serpini1'
ID387068
Institutional Source Beutler Lab
Gene Symbol Serpini1
Ensembl Gene ENSMUSG00000027834
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 1
SynonymsNeuroserpin, Spi17, Ns, PI12
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75557547-75643495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75616660 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 192 (S192P)
Ref Sequence ENSEMBL: ENSMUSP00000123845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029423] [ENSMUST00000161776]
Predicted Effect probably damaging
Transcript: ENSMUST00000029423
AA Change: S192P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029423
Gene: ENSMUSG00000027834
AA Change: S192P

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 397 1.46e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161695
Predicted Effect probably damaging
Transcript: ENSMUST00000161776
AA Change: S192P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123845
Gene: ENSMUSG00000027834
AA Change: S192P

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 207 1.15e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195285
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene show no change in brain morphology or histology. However, they show an increase avoidance of novel stimuli and increased anxiety responses in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Serpini1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Serpini1 APN 3 75640695 nonsense probably null
IGL02131:Serpini1 APN 3 75640704 missense probably benign 0.15
IGL02265:Serpini1 APN 3 75619269 missense probably damaging 0.96
IGL03151:Serpini1 APN 3 75613296 missense probably benign 0.00
IGL03232:Serpini1 APN 3 75638010 splice site probably benign
IGL03256:Serpini1 APN 3 75619174 missense probably benign 0.04
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0449:Serpini1 UTSW 3 75613341 missense probably benign 0.06
R0941:Serpini1 UTSW 3 75616627 missense probably damaging 0.97
R1641:Serpini1 UTSW 3 75614670 missense possibly damaging 0.94
R1968:Serpini1 UTSW 3 75614478 missense probably benign 0.34
R1993:Serpini1 UTSW 3 75614664 missense probably damaging 1.00
R2159:Serpini1 UTSW 3 75623944 missense probably benign 0.06
R3418:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3419:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3780:Serpini1 UTSW 3 75614635 missense probably damaging 0.96
R4618:Serpini1 UTSW 3 75616576 missense probably benign 0.29
R4864:Serpini1 UTSW 3 75613174 missense probably benign 0.01
R4989:Serpini1 UTSW 3 75614488 missense probably benign 0.07
R5324:Serpini1 UTSW 3 75640294 missense probably damaging 1.00
R5767:Serpini1 UTSW 3 75613081 splice site probably benign
R5817:Serpini1 UTSW 3 75613324 missense probably benign 0.07
R5912:Serpini1 UTSW 3 75616607 missense probably benign 0.04
R5944:Serpini1 UTSW 3 75640299 missense probably damaging 1.00
R6704:Serpini1 UTSW 3 75637948 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGGACTACTCTATGAGATGGTG -3'
(R):5'- AGCCTCTGGAAATACAGCCAAG -3'

Sequencing Primer
(F):5'- CTATGAGATGGTGGTATTGATAACTC -3'
(R):5'- TCCACAAGGAGTTGAAGCC -3'
Posted On2016-06-06