Incidental Mutation 'R5080:Lce1e'
ID387069
Institutional Source Beutler Lab
Gene Symbol Lce1e
Ensembl Gene ENSMUSG00000068889
Gene Namelate cornified envelope 1E
Synonyms
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5080 (G1)
Quality Score214
Status Validated
Chromosome3
Chromosomal Location92707401-92709074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92707830 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 70 (C70Y)
Ref Sequence ENSEMBL: ENSMUSP00000088380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090867]
Predicted Effect unknown
Transcript: ENSMUST00000090867
AA Change: C70Y
SMART Domains Protein: ENSMUSP00000088380
Gene: ENSMUSG00000068889
AA Change: C70Y

DomainStartEndE-ValueType
Pfam:LCE 25 68 3.8e-12 PFAM
Pfam:LCE 64 129 7.3e-10 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Lce1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0691:Lce1e UTSW 3 92707756 missense unknown
R1370:Lce1e UTSW 3 92707843 missense unknown
R1759:Lce1e UTSW 3 92707871 nonsense probably null
R2842:Lce1e UTSW 3 92707749 missense unknown
R4451:Lce1e UTSW 3 92707660 missense unknown
R4863:Lce1e UTSW 3 92707871 nonsense probably null
R4983:Lce1e UTSW 3 92707828 missense unknown
R6017:Lce1e UTSW 3 92707933 nonsense probably null
Z1088:Lce1e UTSW 3 92707849 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTCTTCCTCACCCAGCTCAG -3'
(R):5'- AGATGTCCTGTCAGCAGAGC -3'

Sequencing Primer
(F):5'- CAGACTGCTGGCTACTGC -3'
(R):5'- TGCCAGCCTCCTCCAAAGTG -3'
Posted On2016-06-06