Incidental Mutation 'R5080:Wdr37'
ID387092
Institutional Source Beutler Lab
Gene Symbol Wdr37
Ensembl Gene ENSMUSG00000021147
Gene NameWD repeat domain 37
Synonyms3110035P10Rik, 4933417A01Rik
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location8802968-8871909 bp(-) (GRCm38)
Type of Mutationunclassified (6 bp from exon)
DNA Base Change (assembly) A to T at 8847674 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021572] [ENSMUST00000054251] [ENSMUST00000164183] [ENSMUST00000176098] [ENSMUST00000176329] [ENSMUST00000176587] [ENSMUST00000176715] [ENSMUST00000176813] [ENSMUST00000176922]
Predicted Effect probably null
Transcript: ENSMUST00000021572
AA Change: L182*
SMART Domains Protein: ENSMUSP00000021572
Gene: ENSMUSG00000021147
AA Change: L182*

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
WD40 145 185 9.75e-3 SMART
WD40 188 227 4.27e-8 SMART
WD40 272 311 1.06e-3 SMART
WD40 314 353 4.91e-8 SMART
WD40 358 396 2.38e-6 SMART
Blast:WD40 400 438 8e-17 BLAST
WD40 445 486 6.19e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000054251
AA Change: L182*
SMART Domains Protein: ENSMUSP00000062174
Gene: ENSMUSG00000021147
AA Change: L182*

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
WD40 145 185 9.75e-3 SMART
WD40 188 227 4.27e-8 SMART
WD40 272 311 1.06e-3 SMART
WD40 314 353 4.91e-8 SMART
WD40 358 396 2.38e-6 SMART
Blast:WD40 400 438 8e-17 BLAST
WD40 445 486 6.19e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164183
SMART Domains Protein: ENSMUSP00000131469
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176098
AA Change: L13*
SMART Domains Protein: ENSMUSP00000135094
Gene: ENSMUSG00000021147
AA Change: L13*

DomainStartEndE-ValueType
WD40 19 58 4.27e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176329
AA Change: L137*
SMART Domains Protein: ENSMUSP00000135101
Gene: ENSMUSG00000021147
AA Change: L137*

DomainStartEndE-ValueType
WD40 100 140 9.75e-3 SMART
WD40 143 182 4.27e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176429
AA Change: L62*
SMART Domains Protein: ENSMUSP00000134916
Gene: ENSMUSG00000021147
AA Change: L62*

DomainStartEndE-ValueType
WD40 26 66 9.75e-3 SMART
WD40 69 113 3.81e-5 SMART
WD40 118 156 2.38e-6 SMART
Blast:WD40 160 193 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176587
SMART Domains Protein: ENSMUSP00000135271
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
coiled coil region 62 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176715
Predicted Effect probably null
Transcript: ENSMUST00000176813
SMART Domains Protein: ENSMUSP00000135097
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
SCOP:d1ijqa1 128 180 3e-4 SMART
Blast:WD40 145 180 5e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176922
SMART Domains Protein: ENSMUSP00000135742
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221401
Meta Mutation Damage Score 0.496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Wdr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr37 APN 13 8820505 missense probably damaging 1.00
IGL00753:Wdr37 APN 13 8861174 missense probably damaging 1.00
IGL02479:Wdr37 APN 13 8842784 missense probably damaging 1.00
profound UTSW 13 8842728 critical splice donor site probably null
radical UTSW 13 8847674 unclassified probably null
R0885:Wdr37 UTSW 13 8835252 intron probably null
R1073:Wdr37 UTSW 13 8805840 missense probably damaging 0.99
R1085:Wdr37 UTSW 13 8805928 missense probably damaging 1.00
R1537:Wdr37 UTSW 13 8837003 missense probably benign 0.01
R1538:Wdr37 UTSW 13 8836792 missense probably benign
R1541:Wdr37 UTSW 13 8820538 missense probably benign 0.26
R1868:Wdr37 UTSW 13 8836851 missense probably damaging 1.00
R2240:Wdr37 UTSW 13 8861232 start gained probably benign
R3815:Wdr37 UTSW 13 8853596 intron probably benign
R3817:Wdr37 UTSW 13 8853596 intron probably benign
R3818:Wdr37 UTSW 13 8853596 intron probably benign
R3819:Wdr37 UTSW 13 8853596 intron probably benign
R4721:Wdr37 UTSW 13 8854029 missense possibly damaging 0.89
R6297:Wdr37 UTSW 13 8842728 critical splice donor site probably null
R6761:Wdr37 UTSW 13 8849648 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGACTACCCTGTACCCTGAC -3'
(R):5'- CTTAGGTCGGGTGAATTGTACAAAG -3'

Sequencing Primer
(F):5'- CTGTACCCTGACTTACATCAAATG -3'
(R):5'- CTCAGTGGTTAGGAACACTGGC -3'
Posted On2016-06-06