Incidental Mutation 'R0427:Ttc14'
ID38724
Institutional Source Beutler Lab
Gene Symbol Ttc14
Ensembl Gene ENSMUSG00000027677
Gene Nametetratricopeptide repeat domain 14
SynonymscI-44, 2700016E08Rik, 4930434D01Rik, 4931403I22Rik, 4933402I15Rik
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R0427 (G1)
Quality Score177
Status Not validated
Chromosome3
Chromosomal Location33799832-33814860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33803484 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 245 (S245P)
Ref Sequence ENSEMBL: ENSMUSP00000103845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000196139] [ENSMUST00000196369] [ENSMUST00000196975] [ENSMUST00000198529] [ENSMUST00000199222] [ENSMUST00000200271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099153
AA Change: S245P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677
AA Change: S245P

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108210
AA Change: S245P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677
AA Change: S245P

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117915
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196139
SMART Domains Protein: ENSMUSP00000143173
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
SCOP:d1go3e_ 144 217 3e-5 SMART
Blast:S1 154 217 2e-39 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000196369
AA Change: S143P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142863
Gene: ENSMUSG00000027677
AA Change: S143P

DomainStartEndE-ValueType
S1 21 105 7.28e-2 SMART
TPR 204 237 6.19e-1 SMART
TPR 238 271 2.11e-3 SMART
TPR 279 312 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196975
SMART Domains Protein: ENSMUSP00000142684
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 4.6e-4 SMART
TPR 254 287 3e-3 SMART
TPR 288 321 1e-5 SMART
TPR 329 362 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197592
Predicted Effect probably damaging
Transcript: ENSMUST00000198529
AA Change: S245P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143073
Gene: ENSMUSG00000027677
AA Change: S245P

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
Pfam:TPR_11 304 371 2.1e-12 PFAM
Pfam:TPR_2 306 339 1.9e-4 PFAM
Pfam:TPR_1 308 339 1.3e-4 PFAM
Pfam:TPR_1 340 373 2.9e-5 PFAM
Pfam:TPR_2 340 373 6.8e-4 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199222
AA Change: S245P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677
AA Change: S245P

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199523
Predicted Effect probably damaging
Transcript: ENSMUST00000200271
AA Change: S242P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143738
Gene: ENSMUSG00000027677
AA Change: S242P

DomainStartEndE-ValueType
S1 120 204 7.28e-2 SMART
TPR 303 336 6.19e-1 SMART
TPR 337 370 2.11e-3 SMART
TPR 378 411 1.88e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200559
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Ttc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ttc14 APN 3 33803099 missense probably benign 0.35
IGL01326:Ttc14 APN 3 33801358 missense probably benign 0.14
R0196:Ttc14 UTSW 3 33809254 unclassified probably benign
R1713:Ttc14 UTSW 3 33802920 missense probably damaging 1.00
R2312:Ttc14 UTSW 3 33807835 splice site probably null
R2434:Ttc14 UTSW 3 33801078 missense probably benign 0.40
R4794:Ttc14 UTSW 3 33803149 missense probably benign 0.00
R4825:Ttc14 UTSW 3 33801369 missense possibly damaging 0.88
R4888:Ttc14 UTSW 3 33806875 nonsense probably null
R5143:Ttc14 UTSW 3 33808901 unclassified probably benign
R6051:Ttc14 UTSW 3 33808924 unclassified probably benign
R6270:Ttc14 UTSW 3 33800388 missense possibly damaging 0.68
R6415:Ttc14 UTSW 3 33803575 missense possibly damaging 0.81
R6439:Ttc14 UTSW 3 33808819 unclassified probably benign
R7021:Ttc14 UTSW 3 33803497 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCCACACATGGCTGGCATTAAAC -3'
(R):5'- TGTAGCCTCTGAGCTAATCCACACC -3'

Sequencing Primer
(F):5'- CATGGCTGGCATTAAACTAGGTG -3'
(R):5'- CCCTCACCACCTTTATCAGCTAAG -3'
Posted On2013-05-23