Incidental Mutation 'R5084:Vmn2r92'
ID387339
Institutional Source Beutler Lab
Gene Symbol Vmn2r92
Ensembl Gene ENSMUSG00000091350
Gene Namevomeronasal 2, receptor 92
SynonymsEG627111
MMRRC Submission 042673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5084 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18151887-18188886 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 18185177 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 861 (*861W)
Ref Sequence ENSEMBL: ENSMUSP00000128685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169686]
Predicted Effect probably null
Transcript: ENSMUST00000169686
AA Change: *861W
SMART Domains Protein: ENSMUSP00000128685
Gene: ENSMUSG00000091350
AA Change: *861W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 463 4.7e-38 PFAM
Pfam:NCD3G 510 564 2.5e-19 PFAM
Pfam:7tm_3 597 832 1.1e-52 PFAM
low complexity region 843 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,326,917 E59D probably damaging Het
Akap7 T A 10: 25,279,742 probably benign Het
Anpep C A 7: 79,826,870 probably null Het
Aste1 T A 9: 105,397,687 Y314* probably null Het
Ccdc183 G A 2: 25,608,790 T497I probably damaging Het
Cd4 A T 6: 124,870,439 I254N probably damaging Het
Crot G T 5: 8,969,994 H449Q probably damaging Het
Dact2 A T 17: 14,197,952 W164R possibly damaging Het
Dapk3 C A 10: 81,190,318 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbrsl1 G A 5: 110,379,406 probably benign Het
Flg T C 3: 93,277,615 F15L probably damaging Het
Fscn2 A G 11: 120,361,860 D51G probably damaging Het
H2-Ob G T 17: 34,241,128 G71V probably damaging Het
Hmgcs1 T C 13: 119,699,984 V104A possibly damaging Het
Hs3st4 G T 7: 124,397,295 D395Y probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ldlrad3 G A 2: 102,069,984 R58C probably damaging Het
Lpin1 A G 12: 16,576,982 S188P probably damaging Het
Mamdc2 G T 19: 23,359,152 T331K possibly damaging Het
Matr3 G A 18: 35,582,082 S195N probably damaging Het
Nktr T C 9: 121,748,110 Y390H possibly damaging Het
Notch3 C T 17: 32,157,890 probably null Het
Olfm3 T C 3: 114,904,553 probably null Het
Olfr1333 A G 4: 118,829,570 V290A probably damaging Het
Olfr193 C T 16: 59,110,073 C179Y possibly damaging Het
Olfr434 T C 6: 43,217,660 L249P probably damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Olfr866 T A 9: 20,027,255 I228F probably damaging Het
Pask A G 1: 93,322,097 V527A probably benign Het
Pcdha6 A T 18: 36,968,963 N403I probably damaging Het
Peg3 T C 7: 6,707,849 E1458G probably damaging Het
Pip4k2b G A 11: 97,719,743 T386M probably damaging Het
Pkd1l1 T C 11: 8,942,004 M272V probably benign Het
Plcb4 A G 2: 136,002,651 E163G probably damaging Het
Plk5 C A 10: 80,358,889 R149S possibly damaging Het
Pou4f3 A T 18: 42,395,868 Y292F probably damaging Het
Rasgef1c A G 11: 49,969,505 K272E probably damaging Het
Rbl2 C T 8: 91,115,131 T942M probably benign Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Smarca4 T C 9: 21,660,763 L777P probably damaging Het
Smpd1 T C 7: 105,556,978 Y438H probably damaging Het
Sorl1 T C 9: 41,976,377 K2052R probably benign Het
Spata31d1c C A 13: 65,035,130 P162Q probably damaging Het
Ston1 A T 17: 88,636,574 E469D probably benign Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Syde2 AGTTC AGTTCGTTC 3: 146,001,409 probably null Het
Taar5 T A 10: 23,970,938 L78Q probably damaging Het
Tas2r114 A T 6: 131,689,288 L259* probably null Het
Tex37 A G 6: 70,915,704 S20P possibly damaging Het
Topaz1 T A 9: 122,748,818 H264Q probably benign Het
Vcl G T 14: 21,008,959 V548L possibly damaging Het
Vmn2r57 C A 7: 41,426,550 probably null Het
Ylpm1 T G 12: 85,029,321 V940G probably damaging Het
Zfp236 A G 18: 82,609,431 S1500P probably damaging Het
Zfp384 G T 6: 125,023,679 probably benign Het
Zfp786 T C 6: 47,820,019 M662V probably benign Het
Other mutations in Vmn2r92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Vmn2r92 APN 17 18185161 missense unknown
IGL01758:Vmn2r92 APN 17 18152013 nonsense probably null
IGL02614:Vmn2r92 APN 17 18167241 splice site probably benign
IGL03095:Vmn2r92 APN 17 18166710 missense possibly damaging 0.55
IGL03403:Vmn2r92 APN 17 18166852 missense probably damaging 0.98
R0133:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0225:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0227:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0265:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0266:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0267:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0420:Vmn2r92 UTSW 17 18168921 missense probably benign 0.01
R0426:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0494:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R1253:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
R1497:Vmn2r92 UTSW 17 18167363 missense probably benign 0.02
R1571:Vmn2r92 UTSW 17 18152090 missense probably damaging 0.96
R1656:Vmn2r92 UTSW 17 18151936 missense probably benign
R1816:Vmn2r92 UTSW 17 18166677 missense probably damaging 0.98
R2229:Vmn2r92 UTSW 17 18167392 missense probably benign 0.01
R2909:Vmn2r92 UTSW 17 18185115 missense possibly damaging 0.89
R3694:Vmn2r92 UTSW 17 18151943 nonsense probably null
R4207:Vmn2r92 UTSW 17 18184261 missense possibly damaging 0.62
R4548:Vmn2r92 UTSW 17 18171316 missense probably benign
R4612:Vmn2r92 UTSW 17 18166870 missense probably benign 0.25
R4742:Vmn2r92 UTSW 17 18166857 missense probably benign 0.06
R4824:Vmn2r92 UTSW 17 18151921 utr 5 prime probably benign
R4865:Vmn2r92 UTSW 17 18167372 missense probably benign 0.16
R4900:Vmn2r92 UTSW 17 18184343 missense probably benign 0.27
R5140:Vmn2r92 UTSW 17 18152050 missense probably benign 0.07
R5995:Vmn2r92 UTSW 17 18168951 critical splice donor site probably null
R6045:Vmn2r92 UTSW 17 18168043 critical splice donor site probably null
R6269:Vmn2r92 UTSW 17 18166774 missense probably benign 0.01
R6877:Vmn2r92 UTSW 17 18168822 missense probably damaging 1.00
R7151:Vmn2r92 UTSW 17 18166743 missense probably benign 0.01
R7260:Vmn2r92 UTSW 17 18166876 missense probably damaging 1.00
R7344:Vmn2r92 UTSW 17 18167251 missense probably benign 0.01
R7514:Vmn2r92 UTSW 17 18171271 missense not run
X0066:Vmn2r92 UTSW 17 18184895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTACCACAGCACTAAAGGG -3'
(R):5'- AGGCCTTAGAATCAGAACAGTTG -3'

Sequencing Primer
(F):5'- TACCACAGCACTAAAGGGAAGGTC -3'
(R):5'- TCAGAACAGTTGAATCACCAGAG -3'
Posted On2016-06-06