Incidental Mutation 'R5085:2310035C23Rik'
ID387347
Institutional Source Beutler Lab
Gene Symbol 2310035C23Rik
Ensembl Gene ENSMUSG00000026319
Gene NameRIKEN cDNA 2310035C23 gene
Synonyms
MMRRC Submission 042674-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R5085 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105663861-105755191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105678180 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 182 (S182G)
Ref Sequence ENSEMBL: ENSMUSP00000141162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039173
AA Change: S182G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: S182G

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086721
AA Change: S182G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: S182G

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 1.25e-3 SMART
coiled coil region 358 396 N/A INTRINSIC
SCOP:d1b3ua_ 556 1093 5e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186807
AA Change: S182G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319
AA Change: S182G

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 3.9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189091
Predicted Effect probably damaging
Transcript: ENSMUST00000190501
AA Change: S182G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: S182G

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191293
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 92% (69/75)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,973 K129* probably null Het
Adamts6 A T 13: 104,307,243 D162V probably damaging Het
Alms1 C A 6: 85,620,732 P1316T possibly damaging Het
AU040320 A T 4: 126,828,871 N394I possibly damaging Het
Cacng8 T C 7: 3,415,580 L416P possibly damaging Het
Ccdc136 T A 6: 29,419,314 N944K probably damaging Het
Clcn1 C T 6: 42,313,880 T896I probably benign Het
Col16a1 A T 4: 130,054,171 Y228F probably damaging Het
Cyfip1 A G 7: 55,898,335 D561G probably benign Het
Ddr1 T A 17: 35,682,775 probably null Het
Dedd2 A T 7: 25,218,986 L48Q probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dph3b-ps A G 13: 106,547,050 noncoding transcript Het
Dppa3 T C 6: 122,629,932 F127S probably damaging Het
Dpy19l4 C T 4: 11,265,943 probably null Het
Flrt3 T C 2: 140,660,257 T484A probably damaging Het
Gldc T C 19: 30,151,536 E179G probably damaging Het
Gm14403 A G 2: 177,508,489 E76G probably benign Het
Gm6421 G A 13: 117,358,433 noncoding transcript Het
Grk5 T C 19: 61,076,684 V262A probably damaging Het
Grp A G 18: 65,880,159 Q132R probably benign Het
Hap1 A G 11: 100,355,711 F123L probably damaging Het
Hrc A G 7: 45,337,021 D532G probably damaging Het
Igsf9b C A 9: 27,317,437 F164L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl1 C T 11: 104,424,342 R290Q probably damaging Het
Kifc2 T A 15: 76,661,296 L81Q probably damaging Het
Klrc3 T C 6: 129,639,575 R160G probably damaging Het
Mal A G 2: 127,640,273 M70T probably benign Het
Mep1a T G 17: 43,478,144 R580S probably damaging Het
Methig1 A T 15: 100,353,249 I14F probably damaging Het
Mrvi1 G T 7: 110,871,493 L672I probably damaging Het
Mtf1 T C 4: 124,821,308 L242P probably damaging Het
Nfkb1 C A 3: 135,603,807 A509S probably benign Het
Olfr1056 A T 2: 86,355,974 M136K probably damaging Het
Olfr133 G A 17: 38,149,112 D175N probably damaging Het
Olfr1352 G T 10: 78,984,094 M101I probably benign Het
Olfr206 A T 16: 59,345,086 I205K probably damaging Het
Olfr753-ps1 C G 17: 37,169,967 S227T probably benign Het
Pabpc2 A T 18: 39,774,582 N300I probably damaging Het
Peg10 C T 6: 4,755,864 probably benign Het
Ppp1r3a T A 6: 14,719,604 D437V probably damaging Het
Prickle1 A G 15: 93,500,902 S682P probably damaging Het
Prkab2 T C 3: 97,672,992 probably benign Het
Pus3 T A 9: 35,565,636 L243Q possibly damaging Het
Rgs19 G A 2: 181,689,543 T99M possibly damaging Het
Ripk2 A G 4: 16,127,663 S360P possibly damaging Het
Rock1 A G 18: 10,140,210 I127T probably damaging Het
Serpinb10 T G 1: 107,542,217 M143R probably damaging Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Skint6 T A 4: 113,236,268 Q226L probably damaging Het
Slc6a19 T C 13: 73,691,753 M137V probably benign Het
Supv3l1 A T 10: 62,435,512 N415K probably benign Het
Tcrg-V7 A T 13: 19,178,428 K96* probably null Het
Tekt4 A G 17: 25,473,775 R192G probably damaging Het
Tshz1 T C 18: 84,013,928 N785S probably benign Het
Usb1 A G 8: 95,344,051 T202A probably damaging Het
Utp18 A T 11: 93,870,537 D348E possibly damaging Het
Vmn1r42 T G 6: 89,844,616 I324L probably benign Het
Wnt8a A T 18: 34,545,603 R157* probably null Het
Ypel1 A G 16: 17,084,608 probably null Het
Zfp235 A G 7: 24,137,121 K31E probably damaging Het
Zhx2 G C 15: 57,822,693 W486S probably damaging Het
Other mutations in 2310035C23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:2310035C23Rik APN 1 105696599 splice site probably benign
IGL02393:2310035C23Rik APN 1 105687368 missense probably damaging 1.00
IGL02655:2310035C23Rik APN 1 105678246 missense probably damaging 1.00
IGL02992:2310035C23Rik APN 1 105719464 missense possibly damaging 0.89
IGL03170:2310035C23Rik APN 1 105735955 missense probably damaging 0.99
IGL03050:2310035C23Rik UTSW 1 105726381 missense probably damaging 0.98
R0022:2310035C23Rik UTSW 1 105691902 splice site probably benign
R0399:2310035C23Rik UTSW 1 105750959 splice site probably benign
R1243:2310035C23Rik UTSW 1 105750364 missense probably damaging 1.00
R1563:2310035C23Rik UTSW 1 105719534 missense probably damaging 1.00
R1760:2310035C23Rik UTSW 1 105719444 splice site probably benign
R1894:2310035C23Rik UTSW 1 105664576 missense probably benign 0.12
R2036:2310035C23Rik UTSW 1 105743254 missense probably damaging 1.00
R2428:2310035C23Rik UTSW 1 105746126 missense possibly damaging 0.88
R2905:2310035C23Rik UTSW 1 105691994 missense probably benign 0.04
R3121:2310035C23Rik UTSW 1 105725799 missense probably benign 0.15
R3750:2310035C23Rik UTSW 1 105753577 missense probably damaging 1.00
R3886:2310035C23Rik UTSW 1 105692213 missense probably benign 0.14
R4284:2310035C23Rik UTSW 1 105721287 missense probably damaging 0.98
R4671:2310035C23Rik UTSW 1 105718859 missense probably benign 0.00
R4706:2310035C23Rik UTSW 1 105692279 missense probably benign 0.28
R4760:2310035C23Rik UTSW 1 105721305 missense probably benign 0.17
R4776:2310035C23Rik UTSW 1 105719535 nonsense probably null
R5031:2310035C23Rik UTSW 1 105664514 missense probably damaging 1.00
R5051:2310035C23Rik UTSW 1 105691986 missense possibly damaging 0.85
R5104:2310035C23Rik UTSW 1 105731240 missense probably benign 0.45
R5187:2310035C23Rik UTSW 1 105718809 nonsense probably null
R5259:2310035C23Rik UTSW 1 105721376 missense probably benign 0.01
R5435:2310035C23Rik UTSW 1 105741250 intron probably benign
R5444:2310035C23Rik UTSW 1 105726384 missense possibly damaging 0.60
R5490:2310035C23Rik UTSW 1 105719501 missense probably damaging 0.99
R5513:2310035C23Rik UTSW 1 105750973 missense probably damaging 0.99
R5556:2310035C23Rik UTSW 1 105693167 missense probably benign
R5734:2310035C23Rik UTSW 1 105703883 intron probably benign
R5779:2310035C23Rik UTSW 1 105687347 missense probably damaging 1.00
R5822:2310035C23Rik UTSW 1 105718856 missense probably damaging 1.00
R5878:2310035C23Rik UTSW 1 105692960 missense probably benign
R6015:2310035C23Rik UTSW 1 105691958 missense probably damaging 1.00
R6051:2310035C23Rik UTSW 1 105721272 missense probably damaging 1.00
R6266:2310035C23Rik UTSW 1 105731282 critical splice donor site probably null
R6556:2310035C23Rik UTSW 1 105726440 missense probably damaging 1.00
R6571:2310035C23Rik UTSW 1 105692982 missense probably benign
R6612:2310035C23Rik UTSW 1 105692007 missense possibly damaging 0.72
R6852:2310035C23Rik UTSW 1 105753595 missense probably damaging 1.00
R7209:2310035C23Rik UTSW 1 105750357 missense probably damaging 1.00
R7284:2310035C23Rik UTSW 1 105734583 missense probably benign 0.01
R7292:2310035C23Rik UTSW 1 105721416 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTTGGTTCATAAGTGGGAC -3'
(R):5'- AGCTTGCCACAAGGAAAATTTAGC -3'

Sequencing Primer
(F):5'- GTTCATAAGTGGGACATAAATTTGGG -3'
(R):5'- GCCACAAGGAAAATTTAGCAAATTG -3'
Posted On2016-06-06