Incidental Mutation 'R0427:Wipf3'
ID38737
Institutional Source Beutler Lab
Gene Symbol Wipf3
Ensembl Gene ENSMUSG00000086040
Gene NameWAS/WASL interacting protein family, member 3
Synonyms
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0427 (G1)
Quality Score207
Status Not validated
Chromosome6
Chromosomal Location54429603-54503768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54483897 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 110 (L110R)
Ref Sequence ENSEMBL: ENSMUSP00000132022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126637] [ENSMUST00000132855] [ENSMUST00000163746] [ENSMUST00000172046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000126637
AA Change: L110R

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116325
Gene: ENSMUSG00000086040
AA Change: L110R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131043
Predicted Effect probably benign
Transcript: ENSMUST00000132855
AA Change: L110R

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120240
Gene: ENSMUSG00000086040
AA Change: L110R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163746
AA Change: L110R

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132022
Gene: ENSMUSG00000086040
AA Change: L110R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172046
AA Change: L110R

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132138
Gene: ENSMUSG00000086040
AA Change: L110R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display impaired spermatogenesis, abnormal sperm head morphology, and significantly reduced male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Wipf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0234:Wipf3 UTSW 6 54496501 missense probably damaging 0.99
R0234:Wipf3 UTSW 6 54496501 missense probably damaging 0.99
R0529:Wipf3 UTSW 6 54485363 missense probably damaging 0.97
R0699:Wipf3 UTSW 6 54483832 missense probably damaging 0.99
R2246:Wipf3 UTSW 6 54489073 missense probably damaging 0.99
R3809:Wipf3 UTSW 6 54481795 missense probably damaging 0.96
R4037:Wipf3 UTSW 6 54481828 missense probably damaging 1.00
R4038:Wipf3 UTSW 6 54481828 missense probably damaging 1.00
R4613:Wipf3 UTSW 6 54485555 missense probably damaging 1.00
R5144:Wipf3 UTSW 6 54485675 missense probably damaging 1.00
R5408:Wipf3 UTSW 6 54481911 missense probably benign 0.25
R5464:Wipf3 UTSW 6 54485323 missense possibly damaging 0.46
R7116:Wipf3 UTSW 6 54481919 critical splice donor site probably null
R7383:Wipf3 UTSW 6 54485278 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACACGCAGTGAAAATGGTGGC -3'
(R):5'- ACGGCGATGGAGATTCATCAGAAC -3'

Sequencing Primer
(F):5'- TGAAAATGGTGGCATTGGGC -3'
(R):5'- atccgcctgtctctgcc -3'
Posted On2013-05-23