Incidental Mutation 'R0427:Ptpro'
ID38741
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0427 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 137368296 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 100 (V100G)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077115
AA Change: V100G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V100G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167679
AA Change: V100G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V100G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203010
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGCATCTGTGTATGTTGTGAG -3'
(R):5'- AAGACCATTGCTGAAGCCTTCCC -3'

Sequencing Primer
(F):5'- TGAGGGTAGCTGGCGAATC -3'
(R):5'- tgtgtgtACCAGCACCAG -3'
Posted On2013-05-23