Incidental Mutation 'R5087:1300017J02Rik'
List |< first << previous [record 20 of 33389] next >> last >|
ID387520
Institutional Source Beutler Lab
Gene Symbol 1300017J02Rik
Ensembl Gene ENSMUSG00000033688
Gene NameRIKEN cDNA 1300017J02 gene
SynonymsmICA
MMRRC Submission 042676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5087 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103250521-103305082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103266221 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 361 (V361M)
Ref Sequence ENSEMBL: ENSMUSP00000115867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035163] [ENSMUST00000123530]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035163
AA Change: V439M

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035163
Gene: ENSMUSG00000033688
AA Change: V439M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.48e-163 SMART
TR_FER 355 697 3.26e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123530
AA Change: V361M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115867
Gene: ENSMUSG00000033688
AA Change: V361M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 351 3.67e-164 SMART
TR_FER 352 619 5.89e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150524
Predicted Effect unknown
Transcript: ENSMUST00000154357
AA Change: V2M
SMART Domains Protein: ENSMUSP00000123519
Gene: ENSMUSG00000033688
AA Change: V2M

DomainStartEndE-ValueType
TR_FER 1 242 5.88e-81 SMART
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A G 1: 9,561,626 probably benign Het
Anln T C 9: 22,375,044 T322A possibly damaging Het
Best3 A T 10: 117,009,002 Y354F probably benign Het
Cd44 C T 2: 102,831,354 V509I possibly damaging Het
Cdk5rap1 T C 2: 154,342,395 N529S probably damaging Het
Cnst A G 1: 179,622,813 D614G possibly damaging Het
Cpq T C 15: 33,212,862 I9T probably benign Het
Cyp2j6 T C 4: 96,531,699 H265R probably damaging Het
Dctn1 T A 6: 83,191,639 M458K probably damaging Het
Disc1 A C 8: 125,132,160 I454L probably benign Het
Dnaja4 A G 9: 54,699,739 E4G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eipr1 C A 12: 28,828,856 N136K probably benign Het
Fut11 A G 14: 20,696,161 N357S probably damaging Het
Gbp2b C T 3: 142,598,254 P37S probably damaging Het
Ghr T G 15: 3,320,140 K519Q probably damaging Het
Gipr C A 7: 19,159,764 C328F probably damaging Het
Gm27013 A T 6: 130,677,670 N276K probably damaging Het
Gm8909 C A 17: 36,165,416 G347* probably null Het
Got2 C A 8: 95,872,323 K150N probably benign Het
Gucy2c A G 6: 136,767,035 S189P possibly damaging Het
Hells T C 19: 38,943,745 V153A probably benign Het
Ighd G A 12: 113,414,427 probably benign Het
Itga4 A C 2: 79,315,629 D725A possibly damaging Het
Itgbl1 T A 14: 123,966,739 L414Q possibly damaging Het
Kat2b-ps A G 5: 93,391,726 noncoding transcript Het
Lrrc1 A T 9: 77,457,458 S192T probably benign Het
Mc2r A T 18: 68,408,203 N6K probably benign Het
Moxd2 A C 6: 40,879,336 L534W probably damaging Het
Myh4 A T 11: 67,255,409 D1431V probably damaging Het
Naa15 T A 3: 51,457,285 probably null Het
Naa16 G A 14: 79,377,415 T215I possibly damaging Het
Ntng1 A T 3: 110,135,329 Y60* probably null Het
Olfr117 A T 17: 37,659,721 V204E probably damaging Het
Olfr389 T C 11: 73,777,258 Y23C possibly damaging Het
Pccb T C 9: 100,985,243 probably benign Het
Pcnx C A 12: 81,994,939 P2115Q probably damaging Het
Pfkfb3 G A 2: 11,484,014 T313I probably damaging Het
Pld1 A G 3: 28,124,582 N875S probably damaging Het
Ptpn20 A T 14: 33,614,441 D79V possibly damaging Het
Rabgap1l C A 1: 160,722,239 V266L probably damaging Het
Reep6 A G 10: 80,335,175 D295G probably damaging Het
Sass6 T C 3: 116,610,298 L195P probably damaging Het
Slc25a27 A G 17: 43,666,930 S25P probably damaging Het
Smok2b T A 17: 13,235,124 M57K probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sspo T C 6: 48,488,471 V71A possibly damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Stard9 T A 2: 120,697,019 Y1252* probably null Het
Syde2 T A 3: 146,007,126 D1006E probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tmc5 G A 7: 118,645,386 A496T possibly damaging Het
Ttn A G 2: 76,736,360 V28063A probably damaging Het
Usp25 A C 16: 77,077,119 I528L probably benign Het
Vmn1r58 C T 7: 5,410,667 S188N probably benign Het
Wfikkn2 A T 11: 94,238,347 C323S probably damaging Het
Zfy1 A C Y: 732,964 S290A unknown Het
Other mutations in 1300017J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:1300017J02Rik APN 9 103254776 missense possibly damaging 0.48
IGL02370:1300017J02Rik APN 9 103263074 missense probably benign 0.27
IGL02899:1300017J02Rik APN 9 103277574 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0831:1300017J02Rik UTSW 9 103269779 missense possibly damaging 0.50
R0849:1300017J02Rik UTSW 9 103263057 missense possibly damaging 0.94
R1225:1300017J02Rik UTSW 9 103254839 splice site probably benign
R2061:1300017J02Rik UTSW 9 103268314 missense probably benign 0.01
R2176:1300017J02Rik UTSW 9 103259367 splice site probably benign
R4915:1300017J02Rik UTSW 9 103251855 nonsense probably null
R4917:1300017J02Rik UTSW 9 103251855 nonsense probably null
R5020:1300017J02Rik UTSW 9 103282502 missense probably benign 0.02
R5033:1300017J02Rik UTSW 9 103279414 missense probably benign 0.36
R5174:1300017J02Rik UTSW 9 103282556 unclassified probably null
R6283:1300017J02Rik UTSW 9 103282635 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACAGTGAACCCTGGCATC -3'
(R):5'- GCAGAACCTTTGACTGGTGATAAC -3'

Sequencing Primer
(F):5'- ACTGGGCATCAAATCTGGGTCATC -3'
(R):5'- TGGTGATAACCAGCGACGGC -3'
Posted On2016-06-06