Incidental Mutation 'R5087:Itgbl1'
ID387534
Institutional Source Beutler Lab
Gene Symbol Itgbl1
Ensembl Gene ENSMUSG00000032925
Gene Nameintegrin, beta-like 1
SynonymsB930011D01Rik, with EGF-like repeat domains
MMRRC Submission 042676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5087 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location123659971-123975618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123966739 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 414 (L414Q)
Ref Sequence ENSEMBL: ENSMUSP00000059019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049681] [ENSMUST00000132026] [ENSMUST00000142161]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049681
AA Change: L414Q

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925
AA Change: L414Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132026
AA Change: L290Q

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925
AA Change: L290Q

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142161
SMART Domains Protein: ENSMUSP00000121659
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G1E|B 59 171 1e-17 PDB
Blast:EGF_like 90 127 5e-15 BLAST
low complexity region 178 192 N/A INTRINSIC
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,266,221 V361M probably damaging Het
Adhfe1 A G 1: 9,561,626 probably benign Het
Anln T C 9: 22,375,044 T322A possibly damaging Het
Best3 A T 10: 117,009,002 Y354F probably benign Het
Cd44 C T 2: 102,831,354 V509I possibly damaging Het
Cdk5rap1 T C 2: 154,342,395 N529S probably damaging Het
Cnst A G 1: 179,622,813 D614G possibly damaging Het
Cpq T C 15: 33,212,862 I9T probably benign Het
Cyp2j6 T C 4: 96,531,699 H265R probably damaging Het
Dctn1 T A 6: 83,191,639 M458K probably damaging Het
Disc1 A C 8: 125,132,160 I454L probably benign Het
Dnaja4 A G 9: 54,699,739 E4G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eipr1 C A 12: 28,828,856 N136K probably benign Het
Fut11 A G 14: 20,696,161 N357S probably damaging Het
Gbp2b C T 3: 142,598,254 P37S probably damaging Het
Ghr T G 15: 3,320,140 K519Q probably damaging Het
Gipr C A 7: 19,159,764 C328F probably damaging Het
Gm27013 A T 6: 130,677,670 N276K probably damaging Het
Gm8909 C A 17: 36,165,416 G347* probably null Het
Got2 C A 8: 95,872,323 K150N probably benign Het
Gucy2c A G 6: 136,767,035 S189P possibly damaging Het
Hells T C 19: 38,943,745 V153A probably benign Het
Ighd G A 12: 113,414,427 probably benign Het
Itga4 A C 2: 79,315,629 D725A possibly damaging Het
Kat2b-ps A G 5: 93,391,726 noncoding transcript Het
Lrrc1 A T 9: 77,457,458 S192T probably benign Het
Mc2r A T 18: 68,408,203 N6K probably benign Het
Moxd2 A C 6: 40,879,336 L534W probably damaging Het
Myh4 A T 11: 67,255,409 D1431V probably damaging Het
Naa15 T A 3: 51,457,285 probably null Het
Naa16 G A 14: 79,377,415 T215I possibly damaging Het
Ntng1 A T 3: 110,135,329 Y60* probably null Het
Olfr117 A T 17: 37,659,721 V204E probably damaging Het
Olfr389 T C 11: 73,777,258 Y23C possibly damaging Het
Pccb T C 9: 100,985,243 probably benign Het
Pcnx C A 12: 81,994,939 P2115Q probably damaging Het
Pfkfb3 G A 2: 11,484,014 T313I probably damaging Het
Pld1 A G 3: 28,124,582 N875S probably damaging Het
Ptpn20 A T 14: 33,614,441 D79V possibly damaging Het
Rabgap1l C A 1: 160,722,239 V266L probably damaging Het
Reep6 A G 10: 80,335,175 D295G probably damaging Het
Sass6 T C 3: 116,610,298 L195P probably damaging Het
Slc25a27 A G 17: 43,666,930 S25P probably damaging Het
Smok2b T A 17: 13,235,124 M57K probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sspo T C 6: 48,488,471 V71A possibly damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Stard9 T A 2: 120,697,019 Y1252* probably null Het
Syde2 T A 3: 146,007,126 D1006E probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tmc5 G A 7: 118,645,386 A496T possibly damaging Het
Ttn A G 2: 76,736,360 V28063A probably damaging Het
Usp25 A C 16: 77,077,119 I528L probably benign Het
Vmn1r58 C T 7: 5,410,667 S188N probably benign Het
Wfikkn2 A T 11: 94,238,347 C323S probably damaging Het
Zfy1 A C Y: 732,964 S290A unknown Het
Other mutations in Itgbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Itgbl1 APN 14 123846432 splice site probably benign
IGL01290:Itgbl1 APN 14 123966725 missense probably benign 0.02
IGL01618:Itgbl1 APN 14 123827799 missense possibly damaging 0.88
IGL02024:Itgbl1 APN 14 123857492 missense probably damaging 1.00
IGL02192:Itgbl1 APN 14 123843926 missense probably damaging 1.00
IGL02215:Itgbl1 APN 14 123972141 missense probably benign 0.01
IGL02400:Itgbl1 APN 14 123846526 missense probably damaging 1.00
IGL02483:Itgbl1 APN 14 123827743 splice site probably benign
H8441:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
R0137:Itgbl1 UTSW 14 123840686 critical splice donor site probably null
R0193:Itgbl1 UTSW 14 123846546 missense probably benign 0.09
R0355:Itgbl1 UTSW 14 123840585 nonsense probably null
R0598:Itgbl1 UTSW 14 123857436 missense possibly damaging 0.93
R0662:Itgbl1 UTSW 14 123827894 missense probably damaging 1.00
R0689:Itgbl1 UTSW 14 123827847 missense possibly damaging 0.65
R1385:Itgbl1 UTSW 14 123661511 splice site probably null
R1957:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3739:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3842:Itgbl1 UTSW 14 123840565 missense possibly damaging 0.92
R4434:Itgbl1 UTSW 14 123972199 missense probably damaging 1.00
R4463:Itgbl1 UTSW 14 123840668 missense probably damaging 0.97
R4696:Itgbl1 UTSW 14 123966708 missense probably damaging 1.00
R4937:Itgbl1 UTSW 14 123973368 missense probably benign 0.12
R5747:Itgbl1 UTSW 14 123972164 nonsense probably null
R6020:Itgbl1 UTSW 14 123846565 missense probably damaging 0.99
R6169:Itgbl1 UTSW 14 123660378 missense probably benign 0.17
R6758:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7213:Itgbl1 UTSW 14 123973297 missense probably damaging 1.00
R7259:Itgbl1 UTSW 14 123843904 missense probably damaging 0.96
V1024:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
X0012:Itgbl1 UTSW 14 123661305 missense probably benign 0.01
X0017:Itgbl1 UTSW 14 123972211 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGTCTAATGGGAGATGAGGACC -3'
(R):5'- GCTGATGCTCTACTTTCAAGGTTC -3'

Sequencing Primer
(F):5'- GAGGACCTATGATTTGCACTTTC -3'
(R):5'- GGTTCACACACAAGCTTAGTGGC -3'
Posted On2016-06-06