Incidental Mutation 'R5089:Syne1'
ID387644
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission 042678-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5089 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 5405444 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 379 (W379*)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000214945] [ENSMUST00000215295]
Predicted Effect probably null
Transcript: ENSMUST00000041639
AA Change: W379*
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: W379*

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000214945
AA Change: W372*
Predicted Effect probably null
Transcript: ENSMUST00000215295
AA Change: W379*
Meta Mutation Damage Score 0.518 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,786,246 L176H probably damaging Het
1700030J22Rik T C 8: 116,971,933 N145S possibly damaging Het
4932438A13Rik T A 3: 36,987,502 D2676E probably benign Het
A230050P20Rik A T 9: 20,868,916 M1L probably benign Het
Acp2 T C 2: 91,211,922 probably benign Het
Adgrf2 G A 17: 42,710,097 A612V probably benign Het
Cct3 T G 3: 88,300,843 M46R probably damaging Het
Cdc123 T C 2: 5,805,000 D200G probably benign Het
Cdh9 T A 15: 16,778,276 F59Y probably damaging Het
Cluh A G 11: 74,660,372 E349G probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Crbn T C 6: 106,781,718 H381R possibly damaging Het
Crim1 A G 17: 78,374,090 D991G probably damaging Het
Dhx16 A T 17: 35,884,089 M503L probably damaging Het
Dthd1 A G 5: 62,849,905 T650A probably benign Het
Etfa T A 9: 55,488,866 K139* probably null Het
Flnc T C 6: 29,447,813 I1205T probably damaging Het
Fzd6 T A 15: 39,007,480 C32S probably damaging Het
Gm1110 T A 9: 26,882,387 D515V probably damaging Het
Gm7676 T C 8: 13,896,401 noncoding transcript Het
Gpr157 T C 4: 150,102,293 S293P possibly damaging Het
Hc T C 2: 35,024,890 D810G probably benign Het
Helz2 T C 2: 181,235,149 H1184R probably benign Het
Hoxc5 A T 15: 103,014,055 probably benign Het
Iah1 C T 12: 21,323,308 S196L possibly damaging Het
Il5 C T 11: 53,721,828 T55I possibly damaging Het
Kras T C 6: 145,225,143 K169E probably benign Het
Larp1 C A 11: 58,047,867 T492K possibly damaging Het
Lgr5 T C 10: 115,478,423 D203G probably damaging Het
Lpcat2 G A 8: 92,879,443 V241M probably damaging Het
Mpeg1 G A 19: 12,462,997 M606I probably benign Het
Ms4a1 G A 19: 11,258,812 P4S probably benign Het
Nat10 A T 2: 103,757,143 probably benign Het
Ncaph2 T A 15: 89,355,945 probably null Het
Nfat5 T A 8: 107,351,438 V403D probably damaging Het
Olfr1214 A G 2: 88,988,172 F10S probably damaging Het
Olfr1380 T A 11: 49,564,413 M164K possibly damaging Het
Pax7 T C 4: 139,830,265 H65R probably damaging Het
Phf20 C A 2: 156,302,862 H797N probably benign Het
Pkhd1l1 T A 15: 44,591,887 S4015T probably benign Het
Prdm5 C T 6: 65,856,090 H148Y probably benign Het
Prpf8 A G 11: 75,509,228 probably null Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sardh A G 2: 27,239,613 probably null Het
Serpinb6b G A 13: 32,978,150 E192K probably benign Het
Skor1 A G 9: 63,145,923 S216P probably damaging Het
Slc51a A G 16: 32,477,546 probably null Het
Smarcb1 T C 10: 75,915,179 T74A probably benign Het
Spg11 A T 2: 122,114,717 Y107* probably null Het
Stk25 T A 1: 93,624,608 K350M probably benign Het
Taco1 A T 11: 106,069,611 E126V probably benign Het
Tbc1d12 T A 19: 38,916,788 L649* probably null Het
Trpm3 G A 19: 22,766,756 G238R probably damaging Het
Yy1 C A 12: 108,793,737 Q109K probably damaging Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6885:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024
R7099:Syne1 UTSW 10 5123744 missense not run
R7107:Syne1 UTSW 10 5132078 missense not run
R7120:Syne1 UTSW 10 5293971 missense not run
R7127:Syne1 UTSW 10 5243180 missense not run
R7128:Syne1 UTSW 10 5243180 missense not run
R7131:Syne1 UTSW 10 5228221 missense not run
R7132:Syne1 UTSW 10 5243180 missense not run
R7133:Syne1 UTSW 10 5231592 missense not run
R7135:Syne1 UTSW 10 5233409 missense not run
R7147:Syne1 UTSW 10 5249340 missense not run
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATATCCAGAAGTGCCCAG -3'
(R):5'- AACAACATAGTGGAGTGCTCTC -3'

Sequencing Primer
(F):5'- AGGGCAGCCTCACCAGAG -3'
(R):5'- CTCTCCAAAGGTGAGCTATGG -3'
Posted On2016-06-06