Incidental Mutation 'R5089:Cdh9'
ID387655
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Namecadherin 9
SynonymsT1-cadherin
MMRRC Submission 042678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R5089 (G1)
Quality Score192
Status Validated
Chromosome15
Chromosomal Location16728756-16857094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16778276 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 59 (F59Y)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
Predicted Effect probably damaging
Transcript: ENSMUST00000026432
AA Change: F59Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: F59Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228307
AA Change: F59Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,786,246 L176H probably damaging Het
1700030J22Rik T C 8: 116,971,933 N145S possibly damaging Het
4932438A13Rik T A 3: 36,987,502 D2676E probably benign Het
A230050P20Rik A T 9: 20,868,916 M1L probably benign Het
Acp2 T C 2: 91,211,922 probably benign Het
Adgrf2 G A 17: 42,710,097 A612V probably benign Het
Cct3 T G 3: 88,300,843 M46R probably damaging Het
Cdc123 T C 2: 5,805,000 D200G probably benign Het
Cluh A G 11: 74,660,372 E349G probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Crbn T C 6: 106,781,718 H381R possibly damaging Het
Crim1 A G 17: 78,374,090 D991G probably damaging Het
Dhx16 A T 17: 35,884,089 M503L probably damaging Het
Dthd1 A G 5: 62,849,905 T650A probably benign Het
Etfa T A 9: 55,488,866 K139* probably null Het
Flnc T C 6: 29,447,813 I1205T probably damaging Het
Fzd6 T A 15: 39,007,480 C32S probably damaging Het
Gm1110 T A 9: 26,882,387 D515V probably damaging Het
Gm7676 T C 8: 13,896,401 noncoding transcript Het
Gpr157 T C 4: 150,102,293 S293P possibly damaging Het
Hc T C 2: 35,024,890 D810G probably benign Het
Helz2 T C 2: 181,235,149 H1184R probably benign Het
Hoxc5 A T 15: 103,014,055 probably benign Het
Iah1 C T 12: 21,323,308 S196L possibly damaging Het
Il5 C T 11: 53,721,828 T55I possibly damaging Het
Kras T C 6: 145,225,143 K169E probably benign Het
Larp1 C A 11: 58,047,867 T492K possibly damaging Het
Lgr5 T C 10: 115,478,423 D203G probably damaging Het
Lpcat2 G A 8: 92,879,443 V241M probably damaging Het
Mpeg1 G A 19: 12,462,997 M606I probably benign Het
Ms4a1 G A 19: 11,258,812 P4S probably benign Het
Nat10 A T 2: 103,757,143 probably benign Het
Ncaph2 T A 15: 89,355,945 probably null Het
Nfat5 T A 8: 107,351,438 V403D probably damaging Het
Olfr1214 A G 2: 88,988,172 F10S probably damaging Het
Olfr1380 T A 11: 49,564,413 M164K possibly damaging Het
Pax7 T C 4: 139,830,265 H65R probably damaging Het
Phf20 C A 2: 156,302,862 H797N probably benign Het
Pkhd1l1 T A 15: 44,591,887 S4015T probably benign Het
Prdm5 C T 6: 65,856,090 H148Y probably benign Het
Prpf8 A G 11: 75,509,228 probably null Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sardh A G 2: 27,239,613 probably null Het
Serpinb6b G A 13: 32,978,150 E192K probably benign Het
Skor1 A G 9: 63,145,923 S216P probably damaging Het
Slc51a A G 16: 32,477,546 probably null Het
Smarcb1 T C 10: 75,915,179 T74A probably benign Het
Spg11 A T 2: 122,114,717 Y107* probably null Het
Stk25 T A 1: 93,624,608 K350M probably benign Het
Syne1 C T 10: 5,405,444 W379* probably null Het
Taco1 A T 11: 106,069,611 E126V probably benign Het
Tbc1d12 T A 19: 38,916,788 L649* probably null Het
Trpm3 G A 19: 22,766,756 G238R probably damaging Het
Yy1 C A 12: 108,793,737 Q109K probably damaging Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16828362 missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16823406 missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16855926 missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16830947 missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16778225 missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16856232 missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16848601 missense probably benign 0.01
IGL02380:Cdh9 APN 15 16856000 missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16855989 missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16849076 splice site probably null
IGL02679:Cdh9 APN 15 16832230 missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16856049 missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16823454 critical splice donor site probably null
R0726:Cdh9 UTSW 15 16831044 missense probably benign 0.00
R1335:Cdh9 UTSW 15 16850792 missense probably benign 0.00
R1368:Cdh9 UTSW 15 16848482 splice site probably benign
R1766:Cdh9 UTSW 15 16778306 missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16823275 missense probably benign 0.03
R2325:Cdh9 UTSW 15 16778200 missense probably benign
R2424:Cdh9 UTSW 15 16850354 missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16855814 missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16823438 nonsense probably null
R3839:Cdh9 UTSW 15 16823438 nonsense probably null
R4241:Cdh9 UTSW 15 16849079 critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16850388 missense probably benign 0.00
R4576:Cdh9 UTSW 15 16832239 missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16850959 missense probably benign
R4896:Cdh9 UTSW 15 16778156 missense probably benign 0.12
R4961:Cdh9 UTSW 15 16850828 missense probably benign
R5050:Cdh9 UTSW 15 16778147 missense probably benign 0.12
R5268:Cdh9 UTSW 15 16851013 missense probably benign
R5567:Cdh9 UTSW 15 16855844 missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16823285 missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16832100 missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R6441:Cdh9 UTSW 15 16823423 missense probably benign 0.01
X0062:Cdh9 UTSW 15 16848539 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCTTCTGAAGGTGAAGATAATGAGG -3'
(R):5'- TGGTACATTTCACACCTCTCAATGG -3'

Sequencing Primer
(F):5'- ATGAGGACTTACAGTTGTCTTCAAC -3'
(R):5'- CACCTCTCAATGGAAGAATTTACAG -3'
Posted On2016-06-06