Incidental Mutation 'R5090:Atxn7l1'
ID387709
Institutional Source Beutler Lab
Gene Symbol Atxn7l1
Ensembl Gene ENSMUSG00000020564
Gene Nameataxin 7-like 1
SynonymsAtxn7l4, 2810423G08Rik
MMRRC Submission 042679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5090 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location33147693-33373185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33326078 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 51 (S51P)
Ref Sequence ENSEMBL: ENSMUSP00000122982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000136644] [ENSMUST00000144586] [ENSMUST00000146040] [ENSMUST00000154742]
Predicted Effect probably damaging
Transcript: ENSMUST00000090597
AA Change: S51P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564
AA Change: S51P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 143 220 2.5e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125192
AA Change: S147P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564
AA Change: S147P

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 567 597 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 792 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133549
SMART Domains Protein: ENSMUSP00000120569
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136644
AA Change: S124P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000144586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145589
Predicted Effect possibly damaging
Transcript: ENSMUST00000146040
AA Change: S147P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564
AA Change: S147P

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2.3e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 578 590 N/A INTRINSIC
low complexity region 669 699 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 894 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154742
AA Change: S51P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564
AA Change: S51P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 150 218 1.3e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155386
SMART Domains Protein: ENSMUSP00000115463
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,385,199 S1168G probably damaging Het
Acsf2 A T 11: 94,571,269 probably null Het
AI481877 T C 4: 59,111,108 T55A unknown Het
Ankk1 G T 9: 49,421,763 S140R probably damaging Het
Ash1l G T 3: 89,052,877 K2305N probably damaging Het
Asnsd1 C T 1: 53,352,404 probably benign Het
Ccdc88c A G 12: 100,954,180 L394P probably damaging Het
Cd200r1 T A 16: 44,789,561 S48T possibly damaging Het
Cemip T C 7: 83,942,135 E1243G probably damaging Het
Cep192 T A 18: 67,860,546 H1977Q possibly damaging Het
Cep250 T C 2: 155,976,404 L833P probably damaging Het
Chd9 C A 8: 91,026,834 Y1818* probably null Het
Clca3a1 C A 3: 144,737,872 V706L probably benign Het
Cntln T C 4: 84,947,593 V162A probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cux1 T A 5: 136,313,200 N446I possibly damaging Het
Dlg1 G T 16: 31,838,084 G599W probably damaging Het
Dock7 C T 4: 98,991,411 V969I probably benign Het
Ephb3 T C 16: 21,214,487 C74R probably damaging Het
Fads6 T A 11: 115,296,654 T72S probably benign Het
Fra10ac1 C T 19: 38,214,425 R110Q probably damaging Het
Gdf3 T A 6: 122,609,754 L71F probably benign Het
Gm1966 T A 7: 106,600,902 noncoding transcript Het
Gm6685 A G 11: 28,339,253 Y188H probably benign Het
Gm6981 A C 9: 52,002,842 noncoding transcript Het
Gnpda1 T C 18: 38,332,093 T157A probably damaging Het
Grap2 A C 15: 80,638,482 N70H possibly damaging Het
Hdac5 G A 11: 102,197,713 R887C probably damaging Het
Hectd3 T A 4: 117,000,238 probably benign Het
Hmgcr T C 13: 96,650,590 K162E probably benign Het
Inpp5e A T 2: 26,399,371 probably null Het
Kifap3 A G 1: 163,856,076 D442G possibly damaging Het
Lama3 A G 18: 12,542,402 T1015A possibly damaging Het
Lcp2 T A 11: 34,089,725 Y508* probably null Het
Map1b G T 13: 99,430,026 Y2062* probably null Het
Mipep A G 14: 60,802,299 D259G possibly damaging Het
Mmp2 T C 8: 92,852,574 F97S probably damaging Het
Mrpl18 A C 17: 12,913,810 M144R probably damaging Het
Nek9 A G 12: 85,329,842 probably null Het
Nmral1 A T 16: 4,714,531 Y139N probably damaging Het
Notch4 T C 17: 34,580,920 C952R probably damaging Het
Nsf T C 11: 103,910,578 N204D probably benign Het
P2rx4 A T 5: 122,725,055 D197V probably damaging Het
Pak7 A T 2: 136,087,418 I615N probably damaging Het
Parp10 T C 15: 76,241,725 D421G probably damaging Het
Pcdha6 A T 18: 36,968,717 D321V probably benign Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Psmd4 T C 3: 95,035,248 N7S possibly damaging Het
Ptprq A G 10: 107,526,089 V2084A probably damaging Het
Rab3gap1 A G 1: 127,915,678 E263G probably benign Het
Rbm5 A G 9: 107,760,312 probably benign Het
Sacs T C 14: 61,205,253 F1583L probably damaging Het
Sel1l3 G T 5: 53,200,046 H201Q probably benign Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Trim55 A G 3: 19,671,607 N313S probably benign Het
Usp17lb A T 7: 104,841,083 D212E probably benign Het
Xirp2 A G 2: 67,525,470 E3525G possibly damaging Het
Zfp236 T C 18: 82,618,881 T1379A probably benign Het
Zfp553 A T 7: 127,235,487 E71D probably damaging Het
Znrf1 T G 8: 111,538,403 F21V probably benign Het
Other mutations in Atxn7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Atxn7l1 APN 12 33342142 missense probably damaging 1.00
IGL02146:Atxn7l1 APN 12 33368031 missense probably benign
IGL02202:Atxn7l1 APN 12 33342078 missense probably benign 0.05
IGL02804:Atxn7l1 APN 12 33367789 missense probably damaging 1.00
IGL03344:Atxn7l1 APN 12 33326066 missense probably damaging 1.00
R0270:Atxn7l1 UTSW 12 33342151 missense possibly damaging 0.58
R0621:Atxn7l1 UTSW 12 33326100 missense probably benign 0.15
R1840:Atxn7l1 UTSW 12 33371033 unclassified probably null
R1856:Atxn7l1 UTSW 12 33358770 missense probably damaging 1.00
R1992:Atxn7l1 UTSW 12 33358744 missense probably damaging 1.00
R1993:Atxn7l1 UTSW 12 33345977 missense probably benign
R2249:Atxn7l1 UTSW 12 33358840 missense probably damaging 1.00
R2369:Atxn7l1 UTSW 12 33358850 critical splice donor site probably null
R3695:Atxn7l1 UTSW 12 33358697 missense probably damaging 1.00
R3856:Atxn7l1 UTSW 12 33367600 missense probably damaging 1.00
R3976:Atxn7l1 UTSW 12 33325955 missense probably damaging 1.00
R4151:Atxn7l1 UTSW 12 33364482 missense probably damaging 0.96
R4301:Atxn7l1 UTSW 12 33367238 missense probably damaging 1.00
R4305:Atxn7l1 UTSW 12 33341992 missense probably damaging 0.99
R4411:Atxn7l1 UTSW 12 33194887 intron probably benign
R4763:Atxn7l1 UTSW 12 33358878 intron probably benign
R5049:Atxn7l1 UTSW 12 33358687 missense probably benign 0.00
R5134:Atxn7l1 UTSW 12 33372876 missense probably damaging 1.00
R5425:Atxn7l1 UTSW 12 33367120 missense probably damaging 1.00
R6161:Atxn7l1 UTSW 12 33358663 missense possibly damaging 0.62
R6813:Atxn7l1 UTSW 12 33367124 missense probably damaging 0.96
R7248:Atxn7l1 UTSW 12 33367195 missense probably benign 0.26
R7328:Atxn7l1 UTSW 12 33148503 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGGATGCTGGGCTGAATTC -3'
(R):5'- AGACTAGTAGCTGGCTTCCTC -3'

Sequencing Primer
(F):5'- TTTCTCCCCTGTAGAGAGAAGAC -3'
(R):5'- CGTGCCATCATTCTGGGC -3'
Posted On2016-06-06