Incidental Mutation 'R5090:Cd200r1'
ID387721
Institutional Source Beutler Lab
Gene Symbol Cd200r1
Ensembl Gene ENSMUSG00000022667
Gene NameCD200 receptor 1
SynonymsMox2r, OX2R, CD200R
MMRRC Submission 042679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5090 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44765736-44794978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44789561 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 48 (S48T)
Ref Sequence ENSEMBL: ENSMUSP00000138076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057488] [ENSMUST00000134625] [ENSMUST00000231633]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057488
AA Change: S48T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053822
Gene: ENSMUSG00000022667
AA Change: S48T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-47 BLAST
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134625
AA Change: S48T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138076
Gene: ENSMUSG00000022667
AA Change: S48T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231633
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display abnormal sleep patterns including fragmented vigilance states and diminished duration of wakefulness. Mice homozygous for a different knock-out allele exhibit protection from HSV-1 encephalitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,385,199 S1168G probably damaging Het
Acsf2 A T 11: 94,571,269 probably null Het
AI481877 T C 4: 59,111,108 T55A unknown Het
Ankk1 G T 9: 49,421,763 S140R probably damaging Het
Ash1l G T 3: 89,052,877 K2305N probably damaging Het
Asnsd1 C T 1: 53,352,404 probably benign Het
Atxn7l1 T C 12: 33,326,078 S51P probably damaging Het
Ccdc88c A G 12: 100,954,180 L394P probably damaging Het
Cemip T C 7: 83,942,135 E1243G probably damaging Het
Cep192 T A 18: 67,860,546 H1977Q possibly damaging Het
Cep250 T C 2: 155,976,404 L833P probably damaging Het
Chd9 C A 8: 91,026,834 Y1818* probably null Het
Clca3a1 C A 3: 144,737,872 V706L probably benign Het
Cntln T C 4: 84,947,593 V162A probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cux1 T A 5: 136,313,200 N446I possibly damaging Het
Dlg1 G T 16: 31,838,084 G599W probably damaging Het
Dock7 C T 4: 98,991,411 V969I probably benign Het
Ephb3 T C 16: 21,214,487 C74R probably damaging Het
Fads6 T A 11: 115,296,654 T72S probably benign Het
Fra10ac1 C T 19: 38,214,425 R110Q probably damaging Het
Gdf3 T A 6: 122,609,754 L71F probably benign Het
Gm1966 T A 7: 106,600,902 noncoding transcript Het
Gm6685 A G 11: 28,339,253 Y188H probably benign Het
Gm6981 A C 9: 52,002,842 noncoding transcript Het
Gnpda1 T C 18: 38,332,093 T157A probably damaging Het
Grap2 A C 15: 80,638,482 N70H possibly damaging Het
Hdac5 G A 11: 102,197,713 R887C probably damaging Het
Hectd3 T A 4: 117,000,238 probably benign Het
Hmgcr T C 13: 96,650,590 K162E probably benign Het
Inpp5e A T 2: 26,399,371 probably null Het
Kifap3 A G 1: 163,856,076 D442G possibly damaging Het
Lama3 A G 18: 12,542,402 T1015A possibly damaging Het
Lcp2 T A 11: 34,089,725 Y508* probably null Het
Map1b G T 13: 99,430,026 Y2062* probably null Het
Mipep A G 14: 60,802,299 D259G possibly damaging Het
Mmp2 T C 8: 92,852,574 F97S probably damaging Het
Mrpl18 A C 17: 12,913,810 M144R probably damaging Het
Nek9 A G 12: 85,329,842 probably null Het
Nmral1 A T 16: 4,714,531 Y139N probably damaging Het
Notch4 T C 17: 34,580,920 C952R probably damaging Het
Nsf T C 11: 103,910,578 N204D probably benign Het
P2rx4 A T 5: 122,725,055 D197V probably damaging Het
Pak7 A T 2: 136,087,418 I615N probably damaging Het
Parp10 T C 15: 76,241,725 D421G probably damaging Het
Pcdha6 A T 18: 36,968,717 D321V probably benign Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Psmd4 T C 3: 95,035,248 N7S possibly damaging Het
Ptprq A G 10: 107,526,089 V2084A probably damaging Het
Rab3gap1 A G 1: 127,915,678 E263G probably benign Het
Rbm5 A G 9: 107,760,312 probably benign Het
Sacs T C 14: 61,205,253 F1583L probably damaging Het
Sel1l3 G T 5: 53,200,046 H201Q probably benign Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Trim55 A G 3: 19,671,607 N313S probably benign Het
Usp17lb A T 7: 104,841,083 D212E probably benign Het
Xirp2 A G 2: 67,525,470 E3525G possibly damaging Het
Zfp236 T C 18: 82,618,881 T1379A probably benign Het
Zfp553 A T 7: 127,235,487 E71D probably damaging Het
Znrf1 T G 8: 111,538,403 F21V probably benign Het
Other mutations in Cd200r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Cd200r1 APN 16 44794309 missense possibly damaging 0.88
IGL02111:Cd200r1 APN 16 44788781 missense probably damaging 0.99
IGL02549:Cd200r1 APN 16 44789978 missense probably damaging 1.00
IGL03065:Cd200r1 APN 16 44794282 missense probably benign 0.00
R0218:Cd200r1 UTSW 16 44788743 splice site probably benign
R1512:Cd200r1 UTSW 16 44766027 missense probably benign 0.21
R3605:Cd200r1 UTSW 16 44789576 missense possibly damaging 0.90
R3877:Cd200r1 UTSW 16 44790011 missense probably damaging 0.97
R3963:Cd200r1 UTSW 16 44792795 missense probably benign 0.03
R4109:Cd200r1 UTSW 16 44790084 missense possibly damaging 0.95
R4171:Cd200r1 UTSW 16 44792764 missense probably damaging 0.98
R4296:Cd200r1 UTSW 16 44789670 missense probably damaging 0.98
R4396:Cd200r1 UTSW 16 44766054 missense probably benign 0.01
R4922:Cd200r1 UTSW 16 44789676 missense probably damaging 1.00
R5302:Cd200r1 UTSW 16 44792809 missense possibly damaging 0.86
R5686:Cd200r1 UTSW 16 44790164 missense probably damaging 1.00
R5838:Cd200r1 UTSW 16 44766034 missense possibly damaging 0.75
R5886:Cd200r1 UTSW 16 44790203 missense possibly damaging 0.75
R5913:Cd200r1 UTSW 16 44789671 missense possibly damaging 0.50
R6529:Cd200r1 UTSW 16 44789702 missense possibly damaging 0.81
R6959:Cd200r1 UTSW 16 44790176 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACATGCCTGAACCTTTACTTTAG -3'
(R):5'- AGTTCAGGACTGTGGTCAGG -3'

Sequencing Primer
(F):5'- GCCTGAACCTTTACTTTAGAAGATG -3'
(R):5'- TCAGGTGTGGAGGCCCAG -3'
Posted On2016-06-06