Incidental Mutation 'R5091:Runx1t1'
ID387744
Institutional Source Beutler Lab
Gene Symbol Runx1t1
Ensembl Gene ENSMUSG00000006586
Gene Namerunt-related transcription factor 1; translocated to, 1 (cyclin D-related)
SynonymsCbfa2t1h, ETO, MTG8
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location13743436-13893649 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 13846830 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 205 (Q205*)
Ref Sequence ENSEMBL: ENSMUSP00000127109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006761] [ENSMUST00000098256] [ENSMUST00000098257] [ENSMUST00000105566]
Predicted Effect probably null
Transcript: ENSMUST00000006761
AA Change: Q185*
SMART Domains Protein: ENSMUSP00000006761
Gene: ENSMUSG00000006586
AA Change: Q185*

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 68 96 N/A INTRINSIC
TAFH 102 192 1.12e-53 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:NHR2 317 383 6.9e-42 PFAM
SCOP:d1gpua1 384 454 7e-3 SMART
PDB:2KYG|C 417 447 2e-12 PDB
Pfam:zf-MYND 495 531 4e-10 PFAM
low complexity region 543 558 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098256
AA Change: Q178*
SMART Domains Protein: ENSMUSP00000095856
Gene: ENSMUSG00000006586
AA Change: Q178*

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
low complexity region 61 89 N/A INTRINSIC
TAFH 95 185 1.12e-53 SMART
low complexity region 259 270 N/A INTRINSIC
Pfam:NHR2 310 376 7.3e-42 PFAM
SCOP:d1gpua1 377 447 7e-3 SMART
PDB:2KYG|C 410 440 2e-12 PDB
Pfam:zf-MYND 488 524 2.5e-10 PFAM
low complexity region 536 551 N/A INTRINSIC
low complexity region 555 576 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098257
AA Change: Q205*
SMART Domains Protein: ENSMUSP00000095857
Gene: ENSMUSG00000006586
AA Change: Q205*

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 5.2e-43 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 6.7e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105566
AA Change: Q205*
SMART Domains Protein: ENSMUSP00000127109
Gene: ENSMUSG00000006586
AA Change: Q205*

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 3.6e-42 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 1.4e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150583
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene results in increased perinatal lethality and surviving animals show severe growth retardation. The midgut is absent in 25% of mutant animals which could explain increased perinatal mortality. Surviving animals display thinned intestinal walls and dilated lumens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Runx1t1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Runx1t1 APN 4 13835663 missense probably benign 0.07
IGL01600:Runx1t1 APN 4 13841871 missense probably damaging 1.00
IGL02120:Runx1t1 APN 4 13846884 missense probably benign
IGL02172:Runx1t1 APN 4 13859924 missense probably benign 0.00
IGL02429:Runx1t1 APN 4 13865294 splice site probably benign
IGL02730:Runx1t1 APN 4 13860019 missense probably benign 0.01
IGL02870:Runx1t1 APN 4 13889867 missense unknown
IGL02879:Runx1t1 APN 4 13889868 missense unknown
IGL03369:Runx1t1 APN 4 13881107 missense probably damaging 1.00
IGL03047:Runx1t1 UTSW 4 13865882 missense probably damaging 1.00
R1832:Runx1t1 UTSW 4 13835628 splice site probably benign
R1884:Runx1t1 UTSW 4 13835767 missense probably benign 0.00
R2277:Runx1t1 UTSW 4 13771501 missense probably benign 0.00
R4059:Runx1t1 UTSW 4 13889769 missense probably benign 0.33
R4505:Runx1t1 UTSW 4 13889676 missense probably damaging 1.00
R4585:Runx1t1 UTSW 4 13889864 missense unknown
R4586:Runx1t1 UTSW 4 13889864 missense unknown
R4758:Runx1t1 UTSW 4 13865907 missense probably damaging 1.00
R4795:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4796:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4897:Runx1t1 UTSW 4 13771459 start codon destroyed probably null 0.01
R4971:Runx1t1 UTSW 4 13837978 missense probably damaging 1.00
R5009:Runx1t1 UTSW 4 13865231 missense possibly damaging 0.80
R5844:Runx1t1 UTSW 4 13881068 missense probably damaging 1.00
R5968:Runx1t1 UTSW 4 13841890 splice site probably null
R5993:Runx1t1 UTSW 4 13841863 missense probably damaging 0.98
R5993:Runx1t1 UTSW 4 13875490 missense probably benign 0.00
R6329:Runx1t1 UTSW 4 13785136 start codon destroyed probably null 0.38
R6915:Runx1t1 UTSW 4 13865257 missense probably damaging 0.99
R7283:Runx1t1 UTSW 4 13846935 missense probably damaging 1.00
Z1088:Runx1t1 UTSW 4 13865892 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ATGCCCTGACAGCAATGTAG -3'
(R):5'- TGGAGGCTAGCAATTTCAAAGTG -3'

Sequencing Primer
(F):5'- CAATGTAGCTGCATTGCTTAGGC -3'
(R):5'- ACAGATCTTCATCTTGAGACAGG -3'
Posted On2016-06-06