Incidental Mutation 'R5091:Gimap8'
ID387748
Institutional Source Beutler Lab
Gene Symbol Gimap8
Ensembl Gene ENSMUSG00000064262
Gene NameGTPase, IMAP family member 8
SynonymsIAN9, LOC243374
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48647234-48660875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48656647 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 467 (P467S)
Ref Sequence ENSEMBL: ENSMUSP00000145255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078223] [ENSMUST00000203083] [ENSMUST00000203509]
Predicted Effect unknown
Transcript: ENSMUST00000078223
AA Change: A304V
SMART Domains Protein: ENSMUSP00000077350
Gene: ENSMUSG00000064262
AA Change: A304V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203083
AA Change: P467S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145286
Gene: ENSMUSG00000064262
AA Change: P467S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203509
AA Change: P467S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145255
Gene: ENSMUSG00000064262
AA Change: P467S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein is larger than the other gene family members and includes three AIG1 domains (corresponding to the AIG1 protein from Arabidopsis thaliana) whereas other family members have one AIG1 domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Gimap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gimap8 APN 6 48658767 missense probably damaging 1.00
IGL02830:Gimap8 APN 6 48656305 missense probably benign 0.01
Kangchenjunga UTSW 6 48659163 missense probably damaging 1.00
lhotse UTSW 6 48658954 missense possibly damaging 0.74
R1224:Gimap8 UTSW 6 48650695 missense probably benign 0.04
R1386:Gimap8 UTSW 6 48656653 missense probably benign 0.04
R1503:Gimap8 UTSW 6 48647529 critical splice donor site probably null
R1560:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R1681:Gimap8 UTSW 6 48656411 missense probably benign 0.01
R2012:Gimap8 UTSW 6 48656353 missense probably damaging 0.98
R2094:Gimap8 UTSW 6 48650568 missense probably benign 0.00
R2937:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R2938:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R3147:Gimap8 UTSW 6 48650506 missense probably damaging 1.00
R4276:Gimap8 UTSW 6 48659083 missense probably benign 0.35
R4281:Gimap8 UTSW 6 48658820 missense probably benign 0.37
R4294:Gimap8 UTSW 6 48658957 missense probably benign 0.00
R4713:Gimap8 UTSW 6 48658986 missense probably benign 0.23
R4750:Gimap8 UTSW 6 48650427 missense probably benign 0.01
R4896:Gimap8 UTSW 6 48659347 missense possibly damaging 0.85
R4936:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R5041:Gimap8 UTSW 6 48659163 missense probably damaging 1.00
R5215:Gimap8 UTSW 6 48651083 missense possibly damaging 0.88
R5360:Gimap8 UTSW 6 48656302 missense probably damaging 1.00
R6119:Gimap8 UTSW 6 48658954 missense possibly damaging 0.74
R6221:Gimap8 UTSW 6 48658942 missense probably damaging 1.00
R6450:Gimap8 UTSW 6 48656451 missense probably benign 0.03
R7137:Gimap8 UTSW 6 48650253 missense probably damaging 0.99
R7154:Gimap8 UTSW 6 48656188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAGGATCAGGCTCTAGATAAGG -3'
(R):5'- GAGGCTCTGTCCTTGTCATG -3'

Sequencing Primer
(F):5'- TCAGGCTCTAGATAAGGTTATAAAGG -3'
(R):5'- CTGGGGATCAAACTCAGATCTTACG -3'
Posted On2016-06-06