Incidental Mutation 'R5091:Stra6'
ID387760
Institutional Source Beutler Lab
Gene Symbol Stra6
Ensembl Gene ENSMUSG00000032327
Gene Namestimulated by retinoic acid gene 6
Synonyms
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58063788-58153996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58141146 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 174 (L174P)
Ref Sequence ENSEMBL: ENSMUSP00000130232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000085677] [ENSMUST00000128021] [ENSMUST00000128378] [ENSMUST00000133287] [ENSMUST00000134450] [ENSMUST00000134955] [ENSMUST00000136154] [ENSMUST00000136338] [ENSMUST00000147134] [ENSMUST00000150820] [ENSMUST00000167479] [ENSMUST00000170397]
Predicted Effect probably damaging
Transcript: ENSMUST00000034880
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327
AA Change: L174P

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085677
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327
AA Change: L174P

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128378
SMART Domains Protein: ENSMUSP00000115511
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 164 4.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133287
SMART Domains Protein: ENSMUSP00000114346
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 138 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134450
Predicted Effect probably damaging
Transcript: ENSMUST00000134955
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117280
Gene: ENSMUSG00000032327
AA Change: L174P

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 190 1.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136154
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327
AA Change: L174P

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136338
SMART Domains Protein: ENSMUSP00000115314
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 99 4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145886
Predicted Effect probably benign
Transcript: ENSMUST00000147134
SMART Domains Protein: ENSMUSP00000115315
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 162 6.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150820
SMART Domains Protein: ENSMUSP00000122373
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 168 1.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167479
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327
AA Change: L174P

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170397
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327
AA Change: L174P

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Stra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Stra6 APN 9 58152571 missense probably benign 0.01
IGL01885:Stra6 APN 9 58141148 missense probably damaging 1.00
IGL02219:Stra6 APN 9 58140469 missense probably benign 0.18
IGL02550:Stra6 APN 9 58150083 missense possibly damaging 0.95
IGL02745:Stra6 APN 9 58152038 missense probably damaging 1.00
IGL02999:Stra6 APN 9 58135113 missense probably benign 0.19
R0034:Stra6 UTSW 9 58151469 splice site probably null
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0281:Stra6 UTSW 9 58145489 missense probably benign 0.11
R0387:Stra6 UTSW 9 58153183 missense probably benign 0.13
R0879:Stra6 UTSW 9 58135204 critical splice donor site probably null
R1075:Stra6 UTSW 9 58151404 missense possibly damaging 0.79
R1605:Stra6 UTSW 9 58151883 missense probably benign
R1840:Stra6 UTSW 9 58140530 missense probably benign 0.00
R1896:Stra6 UTSW 9 58151883 missense probably benign
R2149:Stra6 UTSW 9 58152539 missense probably benign 0.01
R4016:Stra6 UTSW 9 58135190 missense probably damaging 0.99
R4127:Stra6 UTSW 9 58151218 missense probably damaging 1.00
R4243:Stra6 UTSW 9 58143026 missense probably benign 0.06
R4631:Stra6 UTSW 9 58140832 intron probably benign
R4671:Stra6 UTSW 9 58149234 missense probably benign 0.01
R4688:Stra6 UTSW 9 58135076 critical splice acceptor site probably null
R6179:Stra6 UTSW 9 58135169 missense probably damaging 1.00
R6486:Stra6 UTSW 9 58151422 frame shift probably null
R6593:Stra6 UTSW 9 58151979 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGAAAAGCATCTCTGACGGG -3'
(R):5'- GTTCAGAGCAGCCAAGTTTG -3'

Sequencing Primer
(F):5'- AAAGCATCTCTGACGGGTATGGTC -3'
(R):5'- CCAAGTTTGGTGCAGACGTG -3'
Posted On2016-06-06