Incidental Mutation 'R5091:Aste1'
ID387761
Institutional Source Beutler Lab
Gene Symbol Aste1
Ensembl Gene ENSMUSG00000032567
Gene Nameasteroid homolog 1
Synonyms1100001A21Rik
MMRRC Submission 042680-MU
Accession Numbers

Ncbi RefSeq: NM_025651.4, NM_001164828.1; MGI:1913845

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105395392-105412229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105405004 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 57 (Y57C)
Ref Sequence ENSEMBL: ENSMUSP00000131164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000123807] [ENSMUST00000167674] [ENSMUST00000176350] [ENSMUST00000176770] [ENSMUST00000176940] [ENSMUST00000177074] [ENSMUST00000177293] [ENSMUST00000177402] [ENSMUST00000189758]
Predicted Effect probably damaging
Transcript: ENSMUST00000035181
AA Change: Y570C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567
AA Change: Y570C

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123807
AA Change: Y509C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000123807
AA Change: Y509C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137208
Predicted Effect probably damaging
Transcript: ENSMUST00000167674
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131164
Gene: ENSMUSG00000032567
AA Change: Y57C

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176597
Predicted Effect probably benign
Transcript: ENSMUST00000176770
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176940
Predicted Effect probably benign
Transcript: ENSMUST00000177074
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177293
SMART Domains Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 203 6.7e-64 PFAM
Pfam:Hydrolase 207 519 7.4e-32 PFAM
Pfam:HAD 210 516 1.9e-15 PFAM
Pfam:Hydrolase_like2 272 356 3.8e-20 PFAM
transmembrane domain 564 586 N/A INTRINSIC
Pfam:Cation_ATPase_C 589 761 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216711
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
Allele List at MGI

All alleles(6) : Targeted(4) Gene trapped(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Aste1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Aste1 APN 9 105397844 missense probably damaging 0.99
IGL03161:Aste1 APN 9 105396672 missense probably damaging 1.00
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R1485:Aste1 UTSW 9 105397810 nonsense probably null
R2010:Aste1 UTSW 9 105403502 missense probably damaging 1.00
R5048:Aste1 UTSW 9 105396989 missense probably damaging 1.00
R5084:Aste1 UTSW 9 105397687 nonsense probably null
R5197:Aste1 UTSW 9 105405054 missense probably damaging 1.00
R5294:Aste1 UTSW 9 105402705 splice site probably null
R5617:Aste1 UTSW 9 105397835 missense probably benign 0.00
R5834:Aste1 UTSW 9 105403415 missense probably benign 0.01
R6214:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6215:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6249:Aste1 UTSW 9 105396617 missense probably benign 0.00
R6913:Aste1 UTSW 9 105397408 missense probably benign 0.01
R7069:Aste1 UTSW 9 105396707 critical splice donor site probably null
R7155:Aste1 UTSW 9 105405136 missense probably damaging 1.00
R7360:Aste1 UTSW 9 105397636 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTAGAGAAGCCTGTTCAGCC -3'
(R):5'- TTGGCATCTGCAGTGGTTCC -3'

Sequencing Primer
(F):5'- GCCCCAGGCTAGCATCATC -3'
(R):5'- ATCTGCAGTGGTTCCCAGGC -3'
Posted On2016-06-06