Incidental Mutation 'R5091:Adcy8'
ID387774
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
MMRRC Submission 042680-MU
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64806704 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 467 (S467P)
Ref Sequence ENSEMBL: ENSMUSP00000154029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
Predicted Effect probably damaging
Transcript: ENSMUST00000023007
AA Change: S467P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: S467P

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228014
AA Change: S467P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228109
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 unclassified probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGACCAGCTCTTTTGGGAGAATC -3'
(R):5'- AGCAGGTTCTAAAGTTGGGG -3'

Sequencing Primer
(F):5'- CAGCTCTTTTGGGAGAATCAGCAG -3'
(R):5'- CAGGTTCTAAAGTTGGGGGTTTC -3'
Posted On2016-06-06