Incidental Mutation 'R0427:Kcnh3'
ID38783
Institutional Source Beutler Lab
Gene Symbol Kcnh3
Ensembl Gene ENSMUSG00000037579
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 3
SynonymsElk2, Melk2, C030044P22Rik, ether a go-go like
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0427 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99224861-99242817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99233299 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 518 (M518L)
Ref Sequence ENSEMBL: ENSMUSP00000040548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041415]
Predicted Effect probably benign
Transcript: ENSMUST00000041415
AA Change: M518L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579
AA Change: M518L

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230973
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. An increase in cognitive function was observed when this gene was knocked out, while deletion of the gene resulted in hippocampal hyperexcitability and epilepsy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal long term object recognition memory, spatial reference memory, spatial working memory, and long term potentiation. Mice homozygous for a different knock-out allele exhibit neuron hyperexcitability and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Kcnh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Kcnh3 APN 15 99242473 missense possibly damaging 0.85
IGL00911:Kcnh3 APN 15 99233001 nonsense probably null
IGL01099:Kcnh3 APN 15 99239736 missense probably benign 0.02
IGL01350:Kcnh3 APN 15 99241992 missense probably benign
IGL01375:Kcnh3 APN 15 99226993 nonsense probably null
IGL01611:Kcnh3 APN 15 99229502 missense probably benign 0.04
IGL01920:Kcnh3 APN 15 99233377 missense probably benign 0.16
IGL02282:Kcnh3 APN 15 99228043 critical splice donor site probably null
IGL02581:Kcnh3 APN 15 99238171 missense possibly damaging 0.72
IGL02889:Kcnh3 APN 15 99227110 missense probably null 0.82
R0532:Kcnh3 UTSW 15 99232963 missense probably damaging 1.00
R0538:Kcnh3 UTSW 15 99240958 missense probably benign 0.00
R0552:Kcnh3 UTSW 15 99229456 missense probably damaging 1.00
R1235:Kcnh3 UTSW 15 99242103 unclassified probably null
R1290:Kcnh3 UTSW 15 99227120 splice site probably null
R1499:Kcnh3 UTSW 15 99239915 missense probably benign 0.00
R1517:Kcnh3 UTSW 15 99238209 missense probably damaging 1.00
R1706:Kcnh3 UTSW 15 99238078 missense possibly damaging 0.86
R1973:Kcnh3 UTSW 15 99229400 missense probably damaging 1.00
R2285:Kcnh3 UTSW 15 99241992 missense probably benign
R3196:Kcnh3 UTSW 15 99233981 missense probably damaging 1.00
R3716:Kcnh3 UTSW 15 99232765 missense possibly damaging 0.52
R4619:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4620:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4624:Kcnh3 UTSW 15 99226372 missense probably damaging 1.00
R4701:Kcnh3 UTSW 15 99241945 missense probably benign
R4853:Kcnh3 UTSW 15 99242089 missense possibly damaging 0.56
R4869:Kcnh3 UTSW 15 99242032 missense probably benign 0.06
R4991:Kcnh3 UTSW 15 99232756 missense probably benign 0.00
R5004:Kcnh3 UTSW 15 99226502 nonsense probably null
R5296:Kcnh3 UTSW 15 99241939 missense probably null 0.92
R5317:Kcnh3 UTSW 15 99227941 missense probably benign
R5338:Kcnh3 UTSW 15 99242394 nonsense probably null
R5658:Kcnh3 UTSW 15 99242076 missense possibly damaging 0.77
R5794:Kcnh3 UTSW 15 99232974 missense probably benign 0.01
R5934:Kcnh3 UTSW 15 99226533 missense possibly damaging 0.46
R6303:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6304:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6385:Kcnh3 UTSW 15 99227941 missense probably benign
R6466:Kcnh3 UTSW 15 99238243 missense probably damaging 1.00
R6640:Kcnh3 UTSW 15 99241768 missense probably benign 0.08
R6879:Kcnh3 UTSW 15 99238167 missense probably damaging 1.00
R6984:Kcnh3 UTSW 15 99228552 missense probably benign 0.00
X0028:Kcnh3 UTSW 15 99242100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATCTGCACCATGCTTATCGGAG -3'
(R):5'- CAAACCCCTGGAGGATGTCAAAGTC -3'

Sequencing Primer
(F):5'- CAACTGGAGATCTAGGGTCTACC -3'
(R):5'- TGTCAAAGTCTAGAAGCAGCC -3'
Posted On2013-05-23