Incidental Mutation 'R5092:Capn9'
ID387835
Institutional Source Beutler Lab
Gene Symbol Capn9
Ensembl Gene ENSMUSG00000031981
Gene Namecalpain 9
SynonymsGC36, nCL-4
MMRRC Submission 042681-MU
Accession Numbers

Genbank: NM_023709; MGI: 1920897

Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5092 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124576111-124618731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124597525 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 188 (K188R)
Ref Sequence ENSEMBL: ENSMUSP00000090717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093033]
Predicted Effect probably damaging
Transcript: ENSMUST00000093033
AA Change: K188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090717
Gene: ENSMUSG00000031981
AA Change: K188R

DomainStartEndE-ValueType
CysPc 24 345 1.53e-196 SMART
calpain_III 348 494 1.91e-87 SMART
low complexity region 504 522 N/A INTRINSIC
EFh 565 593 1.25e-2 SMART
EFh 595 623 2.64e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is expressed predominantly in stomach and small intestine and may have specialized functions in the digestive tract. This gene is thought to be associated with gastric cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to ethanol-induced gastric mucosa injury. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,987,667 probably benign Het
4932438A13Rik A T 3: 37,000,085 M3118L probably benign Het
Abca13 T A 11: 9,258,535 L236Q probably damaging Het
Acp2 A T 2: 91,208,046 T255S probably benign Het
Acsf3 A C 8: 122,817,392 R536S probably benign Het
Adgrb1 T G 15: 74,529,815 V220G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atp5b A G 10: 128,083,985 Q74R probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
Casp8 A T 1: 58,844,676 N381Y possibly damaging Het
Cbwd1 A T 19: 24,921,019 probably null Het
Ccdc88b A G 19: 6,848,232 S1218P probably damaging Het
Cdc42bpg C T 19: 6,313,220 P403S probably benign Het
Cdkal1 T A 13: 29,846,239 Y91F probably damaging Het
Cdyl2 T C 8: 116,623,940 N151D possibly damaging Het
Cnot1 T A 8: 95,752,768 R875S possibly damaging Het
Cpd A G 11: 76,811,704 S613P possibly damaging Het
Cyhr1 A T 15: 76,646,312 F269L probably benign Het
Cyp2e1 G T 7: 140,774,735 R492L probably damaging Het
D5Ertd579e G A 5: 36,602,703 T1371M probably benign Het
Dcaf8 A G 1: 172,186,909 T394A probably benign Het
Dgka T C 10: 128,735,833 E117G probably damaging Het
Dock4 G A 12: 40,844,441 V1867I probably benign Het
E2f2 G T 4: 136,186,937 A333S probably benign Het
Eif3l T C 15: 79,084,154 S208P probably benign Het
Elovl3 A T 19: 46,134,522 H179L probably damaging Het
Eml5 T C 12: 98,792,616 D1766G probably damaging Het
Eno4 A G 19: 58,945,591 T75A probably benign Het
Fam135a C T 1: 24,028,807 D94N probably benign Het
Fasn G T 11: 120,815,036 Q1136K probably benign Het
Fcer1a T G 1: 173,225,455 N58T probably damaging Het
Frmd4b T A 6: 97,295,980 D763V probably damaging Het
Gm43518 A G 5: 123,938,234 T115A probably damaging Het
Gria4 C T 9: 4,472,176 E438K probably benign Het
Grin2d T C 7: 45,854,268 E681G probably damaging Het
Gtf3c5 G T 2: 28,582,873 N35K possibly damaging Het
Hydin A G 8: 110,582,668 T4031A probably benign Het
Igfn1 G T 1: 135,964,826 N2185K probably benign Het
Il17rb T C 14: 30,002,376 T174A probably benign Het
Kdm3b T A 18: 34,813,462 C835S probably benign Het
Lgi2 A T 5: 52,538,087 I510N probably damaging Het
Map3k6 A G 4: 133,251,743 E1164G probably benign Het
Mpv17l T A 16: 13,940,673 M1K probably null Het
Myoc T A 1: 162,639,634 L124Q probably damaging Het
Nbeal2 C A 9: 110,626,728 probably null Het
Nek10 A G 14: 14,820,851 K13E possibly damaging Het
Nt5dc2 A G 14: 31,139,032 H491R possibly damaging Het
Olfr1053 T C 2: 86,314,362 Q308R probably benign Het
Olfr1314 A C 2: 112,092,107 M198R possibly damaging Het
Olfr65 T A 7: 103,907,199 Y250* probably null Het
Pclo T A 5: 14,677,308 probably benign Het
Pgm1 A T 5: 64,107,749 N371I possibly damaging Het
Phf20l1 T A 15: 66,636,913 S873T possibly damaging Het
Plch1 T C 3: 63,698,710 T1249A probably benign Het
Plekhn1 A T 4: 156,224,765 I228N possibly damaging Het
Ppp1r12a A T 10: 108,267,402 probably null Het
Ptchd3 T C 11: 121,831,146 Y282H probably damaging Het
Ptprk T A 10: 28,592,773 N1396K probably damaging Het
Rap1gap2 T C 11: 74,438,295 E81G probably damaging Het
Rpf2 T C 10: 40,246,975 M1V probably null Het
Rpgrip1l G A 8: 91,221,384 Q1224* probably null Het
Rreb1 A G 13: 37,928,278 D286G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Senp5 A T 16: 31,989,142 N431K probably benign Het
Serpina1f A C 12: 103,693,550 S158A probably damaging Het
Sertad3 T A 7: 27,476,720 I193N probably damaging Het
Slc22a8 T A 19: 8,594,164 N86K probably damaging Het
Slc6a2 T C 8: 92,994,719 V492A possibly damaging Het
Slf2 T A 19: 44,952,084 D773E probably benign Het
Slmap A C 14: 26,463,589 L272R probably damaging Het
Smyd5 T C 6: 85,445,203 probably benign Het
Snx21 G T 2: 164,786,746 R103L probably damaging Het
Sphk2 T A 7: 45,712,353 probably null Het
Stab1 T C 14: 31,145,855 K1653E probably benign Het
Syde1 A G 10: 78,589,418 V253A probably benign Het
Sympk G T 7: 19,042,659 R492L probably benign Het
Taar7f T C 10: 24,049,553 I15T probably benign Het
Tas2r137 A G 6: 40,491,266 D10G probably benign Het
Tbcc A G 17: 46,891,674 S329G probably benign Het
Teddm3 G A 16: 21,153,150 T223M probably benign Het
Tex14 G T 11: 87,514,842 C860F probably benign Het
Thada A T 17: 84,444,468 L360Q probably damaging Het
Thop1 C A 10: 81,080,578 H473Q probably damaging Het
Tln2 T C 9: 67,256,028 D1075G probably benign Het
Tmem130 G A 5: 144,743,718 T292I probably benign Het
Tmem198b T C 10: 128,801,436 N278S probably benign Het
Ttc21a A T 9: 119,942,665 T177S probably benign Het
Ubr2 A T 17: 46,969,247 C659S probably damaging Het
Vmn2r4 T C 3: 64,390,952 K585R probably benign Het
Vmn2r86 A G 10: 130,446,587 I720T probably damaging Het
Wdr35 G T 12: 8,987,327 W311L probably damaging Het
Zfp39 A T 11: 58,891,202 F245I possibly damaging Het
Zmym5 G A 14: 56,796,779 T325I probably benign Het
Other mutations in Capn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Capn9 APN 8 124591769 missense probably benign
IGL01987:Capn9 APN 8 124576226 missense probably benign 0.01
IGL02150:Capn9 APN 8 124613843 missense probably benign 0.01
IGL02348:Capn9 APN 8 124594677 missense probably damaging 1.00
IGL02720:Capn9 APN 8 124600497 splice site probably benign
IGL02723:Capn9 APN 8 124609183 splice site probably benign
IGL03065:Capn9 APN 8 124605559 missense probably damaging 1.00
IGL03169:Capn9 APN 8 124605877 missense probably damaging 1.00
A2778:Capn9 UTSW 8 124605478 missense possibly damaging 0.95
R0288:Capn9 UTSW 8 124600491 splice site probably benign
R1353:Capn9 UTSW 8 124605566 splice site probably null
R1611:Capn9 UTSW 8 124611512 missense possibly damaging 0.90
R1672:Capn9 UTSW 8 124613831 missense probably benign 0.03
R1682:Capn9 UTSW 8 124611565 splice site probably null
R1729:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1739:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1762:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1783:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1784:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1785:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1836:Capn9 UTSW 8 124605565 critical splice donor site probably null
R1883:Capn9 UTSW 8 124611558 missense probably benign
R1924:Capn9 UTSW 8 124576226 missense probably benign 0.01
R2008:Capn9 UTSW 8 124591685 missense probably damaging 1.00
R2049:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2069:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2131:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2141:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2219:Capn9 UTSW 8 124609159 nonsense probably null
R4193:Capn9 UTSW 8 124600486 missense probably null 0.00
R4707:Capn9 UTSW 8 124613456 missense possibly damaging 0.82
R5386:Capn9 UTSW 8 124605540 missense possibly damaging 0.83
R5697:Capn9 UTSW 8 124589071 missense unknown
R5734:Capn9 UTSW 8 124605844 missense probably damaging 1.00
R5999:Capn9 UTSW 8 124589078 missense probably damaging 1.00
R6026:Capn9 UTSW 8 124605862 missense probably damaging 1.00
R6298:Capn9 UTSW 8 124617454 missense probably benign
R6787:Capn9 UTSW 8 124616185 missense probably benign 0.00
R6856:Capn9 UTSW 8 124597569 missense probably damaging 1.00
R7131:Capn9 UTSW 8 124576278 missense not run
R7149:Capn9 UTSW 8 124605709 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGGCTCAGACTACGATCC -3'
(R):5'- GATACTCATGCCCCTTCTGG -3'

Sequencing Primer
(F):5'- TACGATCCCCTCAAGGTGTCAG -3'
(R):5'- TCTGGGTTGCTCTTTCTGTC -3'
Posted On2016-06-06