Incidental Mutation 'R5092:Brf1'
ID387861
Institutional Source Beutler Lab
Gene Symbol Brf1
Ensembl Gene ENSMUSG00000011158
Gene NameBRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
SynonymsGTF3B, 2510002F24Rik, TAFIII90, TFIIIB90, TAF3C
MMRRC Submission 042681-MU
Accession Numbers

Genbank: NM_028193; MGI: 1919558

Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R5092 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112960085-113000704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112979732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 166 (T166M)
Ref Sequence ENSEMBL: ENSMUSP00000011302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002880] [ENSMUST00000011302] [ENSMUST00000165079] [ENSMUST00000221104] [ENSMUST00000221500] [ENSMUST00000222209] [ENSMUST00000223287] [ENSMUST00000223368]
Predicted Effect probably benign
Transcript: ENSMUST00000002880
SMART Domains Protein: ENSMUSP00000002880
Gene: ENSMUSG00000002803

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
low complexity region 58 68 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
BTB 137 237 1.39e-23 SMART
BACK 243 352 2.81e-14 SMART
Pfam:PHR 393 538 1.2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000011302
AA Change: T166M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158
AA Change: T166M

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165079
SMART Domains Protein: ENSMUSP00000127286
Gene: ENSMUSG00000002803

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
BTB 86 186 1.39e-23 SMART
BACK 192 301 2.81e-14 SMART
Pfam:PHR 342 488 8.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220567
Predicted Effect probably benign
Transcript: ENSMUST00000221104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221415
Predicted Effect probably benign
Transcript: ENSMUST00000221500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221680
Predicted Effect probably benign
Transcript: ENSMUST00000222209
Predicted Effect probably benign
Transcript: ENSMUST00000223287
Predicted Effect probably benign
Transcript: ENSMUST00000223368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223506
Predicted Effect probably benign
Transcript: ENSMUST00000223508
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,987,667 probably benign Het
4932438A13Rik A T 3: 37,000,085 M3118L probably benign Het
Abca13 T A 11: 9,258,535 L236Q probably damaging Het
Acp2 A T 2: 91,208,046 T255S probably benign Het
Acsf3 A C 8: 122,817,392 R536S probably benign Het
Adgrb1 T G 15: 74,529,815 V220G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atp5b A G 10: 128,083,985 Q74R probably benign Het
Capn9 A G 8: 124,597,525 K188R probably damaging Het
Casp8 A T 1: 58,844,676 N381Y possibly damaging Het
Cbwd1 A T 19: 24,921,019 probably null Het
Ccdc88b A G 19: 6,848,232 S1218P probably damaging Het
Cdc42bpg C T 19: 6,313,220 P403S probably benign Het
Cdkal1 T A 13: 29,846,239 Y91F probably damaging Het
Cdyl2 T C 8: 116,623,940 N151D possibly damaging Het
Cnot1 T A 8: 95,752,768 R875S possibly damaging Het
Cpd A G 11: 76,811,704 S613P possibly damaging Het
Cyhr1 A T 15: 76,646,312 F269L probably benign Het
Cyp2e1 G T 7: 140,774,735 R492L probably damaging Het
D5Ertd579e G A 5: 36,602,703 T1371M probably benign Het
Dcaf8 A G 1: 172,186,909 T394A probably benign Het
Dgka T C 10: 128,735,833 E117G probably damaging Het
Dock4 G A 12: 40,844,441 V1867I probably benign Het
E2f2 G T 4: 136,186,937 A333S probably benign Het
Eif3l T C 15: 79,084,154 S208P probably benign Het
Elovl3 A T 19: 46,134,522 H179L probably damaging Het
Eml5 T C 12: 98,792,616 D1766G probably damaging Het
Eno4 A G 19: 58,945,591 T75A probably benign Het
Fam135a C T 1: 24,028,807 D94N probably benign Het
Fasn G T 11: 120,815,036 Q1136K probably benign Het
Fcer1a T G 1: 173,225,455 N58T probably damaging Het
Frmd4b T A 6: 97,295,980 D763V probably damaging Het
Gm43518 A G 5: 123,938,234 T115A probably damaging Het
Gria4 C T 9: 4,472,176 E438K probably benign Het
Grin2d T C 7: 45,854,268 E681G probably damaging Het
Gtf3c5 G T 2: 28,582,873 N35K possibly damaging Het
Hydin A G 8: 110,582,668 T4031A probably benign Het
Igfn1 G T 1: 135,964,826 N2185K probably benign Het
Il17rb T C 14: 30,002,376 T174A probably benign Het
Kdm3b T A 18: 34,813,462 C835S probably benign Het
Lgi2 A T 5: 52,538,087 I510N probably damaging Het
Map3k6 A G 4: 133,251,743 E1164G probably benign Het
Mpv17l T A 16: 13,940,673 M1K probably null Het
Myoc T A 1: 162,639,634 L124Q probably damaging Het
Nbeal2 C A 9: 110,626,728 probably null Het
Nek10 A G 14: 14,820,851 K13E possibly damaging Het
Nt5dc2 A G 14: 31,139,032 H491R possibly damaging Het
Olfr1053 T C 2: 86,314,362 Q308R probably benign Het
Olfr1314 A C 2: 112,092,107 M198R possibly damaging Het
Olfr65 T A 7: 103,907,199 Y250* probably null Het
Pclo T A 5: 14,677,308 probably benign Het
Pgm1 A T 5: 64,107,749 N371I possibly damaging Het
Phf20l1 T A 15: 66,636,913 S873T possibly damaging Het
Plch1 T C 3: 63,698,710 T1249A probably benign Het
Plekhn1 A T 4: 156,224,765 I228N possibly damaging Het
Ppp1r12a A T 10: 108,267,402 probably null Het
Ptchd3 T C 11: 121,831,146 Y282H probably damaging Het
Ptprk T A 10: 28,592,773 N1396K probably damaging Het
Rap1gap2 T C 11: 74,438,295 E81G probably damaging Het
Rpf2 T C 10: 40,246,975 M1V probably null Het
Rpgrip1l G A 8: 91,221,384 Q1224* probably null Het
Rreb1 A G 13: 37,928,278 D286G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Senp5 A T 16: 31,989,142 N431K probably benign Het
Serpina1f A C 12: 103,693,550 S158A probably damaging Het
Sertad3 T A 7: 27,476,720 I193N probably damaging Het
Slc22a8 T A 19: 8,594,164 N86K probably damaging Het
Slc6a2 T C 8: 92,994,719 V492A possibly damaging Het
Slf2 T A 19: 44,952,084 D773E probably benign Het
Slmap A C 14: 26,463,589 L272R probably damaging Het
Smyd5 T C 6: 85,445,203 probably benign Het
Snx21 G T 2: 164,786,746 R103L probably damaging Het
Sphk2 T A 7: 45,712,353 probably null Het
Stab1 T C 14: 31,145,855 K1653E probably benign Het
Syde1 A G 10: 78,589,418 V253A probably benign Het
Sympk G T 7: 19,042,659 R492L probably benign Het
Taar7f T C 10: 24,049,553 I15T probably benign Het
Tas2r137 A G 6: 40,491,266 D10G probably benign Het
Tbcc A G 17: 46,891,674 S329G probably benign Het
Teddm3 G A 16: 21,153,150 T223M probably benign Het
Tex14 G T 11: 87,514,842 C860F probably benign Het
Thada A T 17: 84,444,468 L360Q probably damaging Het
Thop1 C A 10: 81,080,578 H473Q probably damaging Het
Tln2 T C 9: 67,256,028 D1075G probably benign Het
Tmem130 G A 5: 144,743,718 T292I probably benign Het
Tmem198b T C 10: 128,801,436 N278S probably benign Het
Ttc21a A T 9: 119,942,665 T177S probably benign Het
Ubr2 A T 17: 46,969,247 C659S probably damaging Het
Vmn2r4 T C 3: 64,390,952 K585R probably benign Het
Vmn2r86 A G 10: 130,446,587 I720T probably damaging Het
Wdr35 G T 12: 8,987,327 W311L probably damaging Het
Zfp39 A T 11: 58,891,202 F245I possibly damaging Het
Zmym5 G A 14: 56,796,779 T325I probably benign Het
Other mutations in Brf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Brf1 APN 12 112963600 splice site probably benign
IGL01609:Brf1 APN 12 112963591 missense probably damaging 1.00
IGL01610:Brf1 APN 12 112988083 missense probably benign
IGL01622:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01623:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01791:Brf1 APN 12 112962475 missense probably benign 0.00
IGL02037:Brf1 APN 12 112993062 critical splice donor site probably null
IGL02227:Brf1 APN 12 112961774 missense probably damaging 1.00
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0138:Brf1 UTSW 12 112961139 missense probably damaging 0.99
R1345:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1370:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1927:Brf1 UTSW 12 113000344 missense possibly damaging 0.95
R2423:Brf1 UTSW 12 113000199 missense probably benign 0.17
R3608:Brf1 UTSW 12 112961274 missense probably benign 0.00
R3703:Brf1 UTSW 12 112969371 splice site probably null
R4033:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R4817:Brf1 UTSW 12 112972301 missense probably damaging 0.99
R4897:Brf1 UTSW 12 112965887 missense probably benign 0.05
R4985:Brf1 UTSW 12 112969370 splice site probably null
R7138:Brf1 UTSW 12 112970215 missense not run
Predicted Primers PCR Primer
(F):5'- GTTTGTACAATAACGCCCTACTG -3'
(R):5'- TTTAAGAAAACAGCAGCTGAGC -3'

Sequencing Primer
(F):5'- CCTACTCTGAGATCTTTGGC -3'
(R):5'- TGGTGATCGCCTTAACCAG -3'
Posted On2016-06-06