Incidental Mutation 'R5092:Stab1'
ID387868
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Namestabilin 1
SynonymsMS-1
MMRRC Submission 042681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5092 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31139013-31168641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31145855 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1653 (K1653E)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000159249]
Predicted Effect probably benign
Transcript: ENSMUST00000036618
AA Change: K1653E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: K1653E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159249
SMART Domains Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
EGF 110 147 1.26e-2 SMART
EGF 157 191 1.61e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162763
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,987,667 probably benign Het
4932438A13Rik A T 3: 37,000,085 M3118L probably benign Het
Abca13 T A 11: 9,258,535 L236Q probably damaging Het
Acp2 A T 2: 91,208,046 T255S probably benign Het
Acsf3 A C 8: 122,817,392 R536S probably benign Het
Adgrb1 T G 15: 74,529,815 V220G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atp5b A G 10: 128,083,985 Q74R probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
Capn9 A G 8: 124,597,525 K188R probably damaging Het
Casp8 A T 1: 58,844,676 N381Y possibly damaging Het
Cbwd1 A T 19: 24,921,019 probably null Het
Ccdc88b A G 19: 6,848,232 S1218P probably damaging Het
Cdc42bpg C T 19: 6,313,220 P403S probably benign Het
Cdkal1 T A 13: 29,846,239 Y91F probably damaging Het
Cdyl2 T C 8: 116,623,940 N151D possibly damaging Het
Cnot1 T A 8: 95,752,768 R875S possibly damaging Het
Cpd A G 11: 76,811,704 S613P possibly damaging Het
Cyhr1 A T 15: 76,646,312 F269L probably benign Het
Cyp2e1 G T 7: 140,774,735 R492L probably damaging Het
D5Ertd579e G A 5: 36,602,703 T1371M probably benign Het
Dcaf8 A G 1: 172,186,909 T394A probably benign Het
Dgka T C 10: 128,735,833 E117G probably damaging Het
Dock4 G A 12: 40,844,441 V1867I probably benign Het
E2f2 G T 4: 136,186,937 A333S probably benign Het
Eif3l T C 15: 79,084,154 S208P probably benign Het
Elovl3 A T 19: 46,134,522 H179L probably damaging Het
Eml5 T C 12: 98,792,616 D1766G probably damaging Het
Eno4 A G 19: 58,945,591 T75A probably benign Het
Fam135a C T 1: 24,028,807 D94N probably benign Het
Fasn G T 11: 120,815,036 Q1136K probably benign Het
Fcer1a T G 1: 173,225,455 N58T probably damaging Het
Frmd4b T A 6: 97,295,980 D763V probably damaging Het
Gm43518 A G 5: 123,938,234 T115A probably damaging Het
Gria4 C T 9: 4,472,176 E438K probably benign Het
Grin2d T C 7: 45,854,268 E681G probably damaging Het
Gtf3c5 G T 2: 28,582,873 N35K possibly damaging Het
Hydin A G 8: 110,582,668 T4031A probably benign Het
Igfn1 G T 1: 135,964,826 N2185K probably benign Het
Il17rb T C 14: 30,002,376 T174A probably benign Het
Kdm3b T A 18: 34,813,462 C835S probably benign Het
Lgi2 A T 5: 52,538,087 I510N probably damaging Het
Map3k6 A G 4: 133,251,743 E1164G probably benign Het
Mpv17l T A 16: 13,940,673 M1K probably null Het
Myoc T A 1: 162,639,634 L124Q probably damaging Het
Nbeal2 C A 9: 110,626,728 probably null Het
Nek10 A G 14: 14,820,851 K13E possibly damaging Het
Nt5dc2 A G 14: 31,139,032 H491R possibly damaging Het
Olfr1053 T C 2: 86,314,362 Q308R probably benign Het
Olfr1314 A C 2: 112,092,107 M198R possibly damaging Het
Olfr65 T A 7: 103,907,199 Y250* probably null Het
Pclo T A 5: 14,677,308 probably benign Het
Pgm1 A T 5: 64,107,749 N371I possibly damaging Het
Phf20l1 T A 15: 66,636,913 S873T possibly damaging Het
Plch1 T C 3: 63,698,710 T1249A probably benign Het
Plekhn1 A T 4: 156,224,765 I228N possibly damaging Het
Ppp1r12a A T 10: 108,267,402 probably null Het
Ptchd3 T C 11: 121,831,146 Y282H probably damaging Het
Ptprk T A 10: 28,592,773 N1396K probably damaging Het
Rap1gap2 T C 11: 74,438,295 E81G probably damaging Het
Rpf2 T C 10: 40,246,975 M1V probably null Het
Rpgrip1l G A 8: 91,221,384 Q1224* probably null Het
Rreb1 A G 13: 37,928,278 D286G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Senp5 A T 16: 31,989,142 N431K probably benign Het
Serpina1f A C 12: 103,693,550 S158A probably damaging Het
Sertad3 T A 7: 27,476,720 I193N probably damaging Het
Slc22a8 T A 19: 8,594,164 N86K probably damaging Het
Slc6a2 T C 8: 92,994,719 V492A possibly damaging Het
Slf2 T A 19: 44,952,084 D773E probably benign Het
Slmap A C 14: 26,463,589 L272R probably damaging Het
Smyd5 T C 6: 85,445,203 probably benign Het
Snx21 G T 2: 164,786,746 R103L probably damaging Het
Sphk2 T A 7: 45,712,353 probably null Het
Syde1 A G 10: 78,589,418 V253A probably benign Het
Sympk G T 7: 19,042,659 R492L probably benign Het
Taar7f T C 10: 24,049,553 I15T probably benign Het
Tas2r137 A G 6: 40,491,266 D10G probably benign Het
Tbcc A G 17: 46,891,674 S329G probably benign Het
Teddm3 G A 16: 21,153,150 T223M probably benign Het
Tex14 G T 11: 87,514,842 C860F probably benign Het
Thada A T 17: 84,444,468 L360Q probably damaging Het
Thop1 C A 10: 81,080,578 H473Q probably damaging Het
Tln2 T C 9: 67,256,028 D1075G probably benign Het
Tmem130 G A 5: 144,743,718 T292I probably benign Het
Tmem198b T C 10: 128,801,436 N278S probably benign Het
Ttc21a A T 9: 119,942,665 T177S probably benign Het
Ubr2 A T 17: 46,969,247 C659S probably damaging Het
Vmn2r4 T C 3: 64,390,952 K585R probably benign Het
Vmn2r86 A G 10: 130,446,587 I720T probably damaging Het
Wdr35 G T 12: 8,987,327 W311L probably damaging Het
Zfp39 A T 11: 58,891,202 F245I possibly damaging Het
Zmym5 G A 14: 56,796,779 T325I probably benign Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 unclassified probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 intron probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense not run
R7145:Stab1 UTSW 14 31145073 critical splice donor site unknown
R7153:Stab1 UTSW 14 31160584 missense not run
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGACTAATGAGTAGGGCCC -3'
(R):5'- AGGTATACAGCCCTGGAAGC -3'

Sequencing Primer
(F):5'- CTAATGAGTAGGGCCCAGAGTG -3'
(R):5'- TATACAGCCCTGGAAGCAGACTG -3'
Posted On2016-06-06